Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2503
Contig Information
Length 1268 bp
Tissue Shoot grown with cold treatment
Clones 15 Clones [Download: CSV  ,  FASTA ]
whsc1f14    whsc4b09    whsc4b21    whsc11a21    whsc11d16    whsc14b01    whsc19a10    whsc6b16    rwhsc4b09    rwhsc4b21    rwhsc6b16    rwhsc11a21    rwhsc11d16    rwhsc19a10    rwhsc1f14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 14-3-3 protein homologue [Hordeum vulgare subsp. vulgare]
Score 1308
Evalue 4.37911e-142
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2503
CCCCGCCCCTTCCCCCCACGAACCCACAGCGCGCACCCGAGATCCGCAGCCGAAGCCCGTGAGAGCAGCGAAGCGCGAGAGGAAAGGCACTGAACTAGTT
TGCAACAAAGAAGAGGGAAAATGTCTACCGCTGAGGCAACCCGTGAGGAGAATGTGTACATGGCCAAGCTCGCCGAGCAGGCTGAGCGTTACGAGGAAAT
GGTTGAGTTCATGGAGAAGGTCGCAAAGACCGCTGATGTTGGTGAGCTCACTGTTGAGGAGCGCAACCTGCTCTCTGTGGCTTACAAGAATGTGATTGGT
GCCCGGAGGGCTTCCTGGAGGATCATCTCCTCCATTGAGCAGAAGGAGGAGAGCCGTGGGAACGAGGCCTATGTTGCTTCAATCAAGGAGTACCGTACCA
GGATTGAAACCGAGCTCAGCAAGATCTGTGATGGCATCCTCAAGCTTCTGGACTCCCACCTTGTCCCCTCTGCCACTGCAGCAGAGTCCAAGGTGTTCTA
TCTGAAAATGAAGGGTGACTACCACAGGTACCTTGCGGAGTTCAAGGCGGGTGCTGAGAGGAAAGAAGCAGCTGAGAACACTCTTGTAGCATACAAGTCG
GCCCAGGACATCGCGCTTGCTGACTTGCCTACCACCCACCCGATAAGGCTTGGACTTGCACTCAACTTCTCAGTGTTCTACTATGAGATCCTGAACTCTC
CAGACCGTGCTTGCAACCTTGCCAAGCAGGCATTTGATGAAGCTATTGCTGAGCTGGACTCCCTCGGCGAGGAATCCTACAAGGACAGCACCTTGATCAT
GCAACTTCTTCGTGACAACTTGACTCTCTGGACCTCTGATAACGCAGAGGAGGGTGGTGATGAGATCAAGGAAGCCGCCTCAAAGCCAGAGGGAGAGGGG
CACTGATTGGCCGGCCCTTGAGCGTGCCCAAGTTTATTTCTGAGTCCATTTACGCAGCTACCTGTATCATTCGGATCATAAGATGTACTAGGGTCAGTTG
CACTATGTGAATCATAAGATGTGGTAGGATGGTGCTATGCGAAGCGTGTCGAGCTGAAGTACCTAGTGGACTACAGTCATGAGGGCGGTCATGTGGACAT
CGTCGCTTCTTAGTTCATTAGCAGATTTCAAACTATTTCCTGTATTGCAGCACATTATTAGTATTGCTGTATTAGCAATTTTCATGGCTTGTTGATGATT
GATCATACTTGGCGTCAAGCACCCCCCTGAGTTTTTCTTGTCCTACTTCCCTCTCCAAATAATTGACT
page-top