Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2502
Contig Information
Length 840 bp
Tissue Shoot grown with cold treatment
Clones 15 Clones [Download: CSV  ,  FASTA ]
whsc1d12    whsc5b23    whsc5c24    whsc14o01    whsc15h04    whsc20h10    whsc6a07    whsc7m24    rwhsc6a07    rwhsc12a09    rwhsc14o01    rwhsc15h04    rwhsc1d12    rwhsc20h10    rwhsc7m24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein L13a [Triticum aestivum]
Score 988
Evalue 2.94404e-105
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2502
ACATTTGATAAACGAAACAGTTCACCAAGTAGAAAATTTCAAATGAGGGTAGCAGAACTGCATGCATAACAAAGGTTTACCAACCAGATTGTACTATCAG
AGTTACCAAACTACTTAAAATACGACAGAGGTTTCCCAAAACTGATGGCGCACGAAAGCTCTGATATCTCTTAGTATTTGATAGGGGCCAGGATCTCCAG
CTGAGTTCCCAACTTCTCCTCGGCTGCCTTCTCGGCCTTGACGCGGAGCTTCGCCAGTTGCTTTCTCCTGTCGTAGGAGATCTTGGCCTTCTCCTTCCTC
TTTTCCTCCAGCTCCCTGATGGTGTCGGCGTAGTTCCATCCGACCTCCTTGGAGAGCTGGCCGAGGAGGCAGTACCTGTGCCCAGGCTGCAGCCTCAGAA
CCTTGAGCGCGTCGGGGATGACCATGCGCTTGGTCCTGTCGTACGGCGGCGGCACGCCCTCGTACGCCTTGAGCCTGGCGAGCGCGGCCTCGCCCCTCGC
GGTCTTGTGCGGAATCATACCGCGGATGGTGCGCCAGAGGATCTTGGCCGGGGCGCGGAAGTGGATGGGGCCGTGGGAGGGCTTGGTGTTCATCCTCTTG
CGGAGGAAGCGGAGGTACTTCATCTTCTGGCGGACGAGGCCGCCGGACATGCAGATCTCCTCGCATCGGACCACCACCACGCGCTGCCCGTTGAGCAGCT
CCTTGGCGACGATCGAGGCCAGGCGGCCGAGCATGTGGTGGCGGGCGTCCACCACCACGCGCTTGGCGCACACGCCGGAGCCGGACACCATCTCGCCTCT
TACCTGGCGGCGGCGGCGCTACTAGGGTTTGGAGTTCGGC
page-top