Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2501
Contig Information
Length 1955 bp
Tissue Shoot grown with cold treatment
Clones 14 Clones [Download: CSV  ,  FASTA ]
whsc1e05    whsc3n06    whsc17m04    whsc6f19    whsc8p02    rwhsc3n06    rwhsc6f19    rwhsc12f08    rwhsc17m04    rwhsc17m15    rwhsc17m16    rwhsc18i21    rwhsc1e05    rwhsc8p02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit reversibly glycosylated polypeptide [Triticum aestivum]
Score 1938
Evalue 0
Total Hit Count 419
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2501
TTTTTTTTTTGGATAGCAAAGGTATGGTTCACCAGTAAATCAACCAGCAACCAGGGGCTGAATTACATATCAAAACATTGTCTTGCCAGTGTTTCACAAC
TCAGCTAAATAAAGGCTAAAACATCATTGACTCTAGTTTCCTGGCCAAGGATAGATACTTCAGACACAAGGTGCCCCACAACTTAGTCGAACAGACTGAA
GCCCATGTCATCATCACTCTCTTCCTTCTCCACGACCTTCTCTTCTTTCTTTGACTCAGCTGCAGGGGCAGCAGCACCTCCAGCAGCAGGGGCAGCAGCT
GAAACAGCCACACCACCACCACCAGATGGAACCGCAGCAAACTTCTCCCTACCAGCAGCCAAGAGCTCGGTGATGTCCTTGCCCTTCACTTGGGACAGCA
TGAGTTCCATCTTCTCATTGTCGATTTCACAACCAACAGACTCAAGAATGGATGTCAGGTCCTCTGCAGAGGGGCTGGCGTTGCCAGAGAGGTAAGCAAG
CAGATAGGCAGCAATGAACTTCATCTTGGATCGGAGAAGGAAGGAGAGAGCTGAAGGCGGGGCGGCGGCGGAGGGCTCGACCGATCTGCTAGGGTTTCTG
CCTCGTGCCGAATTCGGCACGAGGTTTTTTTTGATTTCTCAAAATTACCATGATAAATATTATTGTCTTGAATTATGTAAATGATAACAAATCCTTGTCC
AGCTACAAAAGAACCACCAGCATAACATGAAAGAAATATAAAAGCTGCTTCAGTAATCTCTTTCTCAAAAAGAGCTATATCTAGGCCCCAACCATACATT
CTTGGCTCCCCAGCCAGCCTACATGGCTGCTGCCTTGCCGTTCCCAGCAGCAACGACGGTATCAGATGGGTTCAGCTCGTCCCAGGCCTCGATCCAGGTG
ACCATGGCATCAGCAAGCTTCACGAAGTAAGGGTCAATCTTGCCAAGCTTCTCCTTGACCTGCTCCGAGAGTGAGATGTAGCACTTCTGGACTGTGTCAC
ACTCCTTGGAGAGGGTGGCGTTCTGGAAGAAGGGGATGATGTCCTCCTGCCAGAAGATGCCCTTGTACTCTTTCTTCAAGTTGACAAATGGGTTGCTAGC
CTTGCTGTGCCACAGGTATGGCAGCCCAGTCTTCACTCCAAGGCTCAAGTGGTCGCAGATGACCTTGACGCACCATCCAGCCCACATGTCATCGTAGCGA
CCAATAGGCTGGCCATCACCCATGAGGCCAAAGTACATTGCAGGGCCAATGAGCTGACGGTCAAAGGCAAGGTTCATGCCACACATGGGGAACAGTGTCC
CCTTGGGAATAGTCAGGACGGCATCAACATACCTGCTGTTCCTCTCACGAGGCTTAACCATCTGTGTGGGTGCATCATAGTCAGGGATGTTCAGCCAAAG
GCCATGAGAGACCGCGGTGGGGGCACCCTCCCTAAGGCTGAAGGGGTATCCACGGACAAAGTCCGCACCTTCACGGTAGGGGTCATACAAGGTGTTGAAG
AAAAACGGGGTGGACGGGCTGAGGAGGTTCTTGATGTGCTGCTCAAGAGCATTGATGTCTTTGCCAGATGGGTCCTTGGCCACGAAGCAGTCGTCATCGA
TGGTGAAGACGTACTTCTTCTTGGAGACCATGTAGCCGAAGCAGCGGCACGCGGAGTCCTTGAAGGAGATGCATGAGGCCTTGGGGCCGAGAATGCGGTT
GATGTCGTTGCGGTTGTAGAGCTCGTAGTCGAAGCCCTCAGGAACCTTGATGACCTTGCTGGGGTCGCCGTCCTGCACGATGATGAGGTGGTACGGCTGG
AAGAAGGGGCGCCACATCTCGAGGAAGTCGAGATTGCGGATGGTCGGGATCACGATGTCCAGCTCGTCCTTGAGCAGCGGCGTTGATGGCACCGACGATC
CGGGCACAGTCACCGTCCCTGCCATTGCTGCCTGGCCGGGATCTCGATCTCGAGC
page-top