Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2493
Contig Information
Length 1337 bp
Tissue Shoot grown with cold treatment
Clones 14 Clones [Download: CSV  ,  FASTA ]
whsc1e20    whsc4p16    whsc13a22    whsc14l14    whsc16b14    whsc17a05    whsc19j23    whsc9f18    whsc9n14    rwhsc14l14    rwhsc16b14    rwhsc17a05    rwhsc19j23    rwhsc1e20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1613
Evalue 2.03439e-177
Total Hit Count 83
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2493
ATTCGGCACGAGGGAACCTTTCTCCTTCTGTCCCGCAAACCCCCGAGAGATCACACCATGTTCGGCTTCGGTCACCACGGCCACCATGGCCAGAACCCCC
CGGCCCACGCTCCGGCCGCCGCCGGCGGCAACCAGCCCACCTTCAAGATCTTCTGCAAGGCTGACGAGGGCTACTGCCTCTCCGTCCGCGACGGCAACGT
CGTCCTCGCCCCCTCCAACCCCCGCGACGAGCACCAGCACTGGTTCAAGGACATGCGCTTCAGCAGCCAGATCAAGGACGAGGAGGGCAACCCCGCCTTT
GCCATCGTCAACAAGGCCACTGGCCTCGCCGTCAAGCACTCGCTCGGCCAGTCCCACCCGGTGAAGCTCGTGCCATTCAACCCGGAGTACCTCGACGAGT
CCGTGATGTGGACGGAGAGCAGCGACGTCGGCAAGGGCTTCCGCTGCATTCGCATGGTGAACAACATCCGCCTCAACTTCGACGCCCTCAACGGCGACAA
GGACCACGGCGGCGTGCACGACGGCACCACCGTCGTCCTCTGGGAGTGGGCCAAGGGCGACAACCAGAGCTGGAAGATCCTCCCCTGGGGCGAAGAGGCC
TACGCCGGAGGCAGCGCCAACGCCCCCCGCGGCGGCTCCTCAGAGCCCACCGTGCGCATCTTCTGCAAGGCAGACGACGGCTTCAGCGCCACCGTCCGCA
ACGGCGCTGTGGTCCTCGCGCCCACCAACCCCCGCGACGAGTACCAGCACTGGTTCAAGGACATGAGGCACAGCAACCGCATCAAGGACGAGGAAGGCTA
CCCGGCCTTCGCCCTCGTCAACAAGGTGACAGGCGAGGCCATCAAGCACTCCCAAGGCGAGGGCCACCCTGTGAAGCTGGTGCCATACAACGCCAACTAC
CAGGACGAGTCAGTGTTGTGGACTGAGAGCCGCGACGTGGGCGCCGGCTTCCGGTGCATCCGCATGGTGAATAACATCTACCTCAACTTTGACGCTCTCC
ACGGCGACAAGGAGCACGGCGGCGTGCGCGACGGCACCTCCCTCGTGCTGTGGAAGTGGTGCGAGGGCGACAACCAGCGCTGGAAGATCCTTCCCTGGTA
AACGTGTCATGCTGCTGAAGCTGAGTTGATCGCCACCGTGACCCGGAGTTGGTAGAGATCGGCCTGTGATCTGTTGCCGTGTCGTTAGAATAAAAGTCGT
GTGCGGTTGGTGATGTGTCCGTGAGTGTGTGTTTAGTTTCTGTCCTGTCGTTGTGTCCTGCTATGGCGAGCTATCCGATGTAATAAGCATTTGGCACTTG
TGCTTGTTTTTCAAANCCATGGATTCGTGATGAGAAC
page-top