Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2486
Contig Information
Length 934 bp
Tissue Shoot grown with cold treatment
Clones 13 Clones [Download: CSV  ,  FASTA ]
whsc1b08    whsc14c17    whsc15i06    whsc18h12    rwhsc12m10    rwhsc14c17    rwhsc15i06    rwhsc16a15    rwhsc18h12    rwhsc1b08    rwhsc1c16    rwhsc20p03    rwhsc8i20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cobalamin-independent methionine synthase [Triticum monococcum]
Score 1115
Evalue 6.66825e-120
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2486
TTTTTTTTTTCCGGAGAAATTTTGTAATTTGAAAACGTAACGTAACAAACTCAAGACTTAGATGATGAACAATTCGCCACTCAGTTTACAATACACACCG
ACAACCGCCTCAAAAACCACCAAATCAAAGGGATGAGCACATGGCGCCGCGCCGCGCCGAGAAACAAACTAGCCTAACCAACAGGTGGATACAGAGACCC
AGATTATTCAAAGTAAACACGGCTATGGTGGCGACATCCTCCTTGCAATTAAAATGGGGGAGCTGCTATACGGCTTACTGCGCCTTGGCGAGCTCGGCGC
GGATCTGCTTGGCGGCCTCGACCATGTTGGTGAGGGCGGGCTTGACCTCGGCATACTTGCGGGTCTTGAGACCGCAGTCGGGGTTCACCCACAGGATGTT
GGTGTCGAGCACCGCGAGCATCTTGTTGACACGGTCGGCGATCTCCTCCTTGGACGGGATCCTGGGGGAGTGGATGTCGTACACGCCCGGGCCAATGCCG
GCGCCGTACACCACGCCCTCGCGGAAGACGGAGAGAAGCTTCTCGTCGGACCGCGAGTTCTCGATGGTGATCACATCGGCGTCCATGTTGATGATGGACT
GGATGATGTCGTTGAAGTTGGAGTAGCACATGTGGGTGTGGATCTGGGTGGTGTCCTGGACACCGCAGTTGGTGATCCTGAAGGAGTGCACGGCCCAGTC
CAAGTAGAAAGCATGCTCCGACTTGCGGAGTGGCAGACCCTCTCTCAAAGCAGCCTCATCGATTTGGATAACCTGAATACCACCAGCCTCAAGGTCCTCG
ACCTCCTTCTTGATTGCAAGAGCAATCTGGTAGCAAGTCTCAAACCTCGGTTGGTCATTTCTGACAAAAGACCAGTTAAGGATTGTGACAGGGCCTGTCA
GCATACCCTTCATTGGGCGAGCCTCGTGCCGAAT
page-top