Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2475
Contig Information
Length 764 bp
Tissue Shoot grown with cold treatment
Clones 12 Clones [Download: CSV  ,  FASTA ]
whsc1b13    whsc1b14    whsc5g24    whsc14j16    whsc20c10    whsc20c21    rwhsc14j16    rwhsc1b13    rwhsc1b14    rwhsc20c04    rwhsc20c10    rwhsc20c21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100193240 [Zea mays] >gi|194690550|gb|ACF79359.1| unknown [Zea mays] >gi|194692752|gb|ACF80460.1| unknown [Zea mays] >gi|194704172|gb|ACF86170.1| unknown [Zea mays] >gi|219886997|gb|ACL53873.1| unknown [Zea mays] >gi|219887209|gb|ACL53979.1| unknown [Zea mays]
Score 822
Evalue 4.3833e-86
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2475
AATCTCGCTGAACGACTACCTCGCGGTGACGTCGATGAAGCACTACACTTTCCTGCCGCACTCCGCCGGTCGCTACTCGGCCAAGCGCTTCCGCAAGGCG
CAGTGCCCCATCATCGAGCGCCTCACCAACTCCCTCATGATGCACGGGCGCAACAACGGAAAGAAGATCATGGCCGTCCGCATCATCAAGCACACCATGG
AGATCATCCACCTCCTCACCGACGCCAACCCCATCCAGATCATCGTTGATGCCATCATCAACAGTGGTCCACGTGAGGATGCTACCCGTATTGGGTCTGC
TGGTGTTGTGAGGAGGCAGGCTGTGGATATCTCCCCCCTGAGGAGGGTGAACCAGGCTATCTACCTTCTGACCACTGGTGCCAGGGAGAGCGCCTTCAGG
AACGTCAAGACCATTGCTGAGTGCCTTGCTGATGAGCTGATCAATGCTGCCAAGGGCTCATCCAACAGCTATGCCATCAAGAAGAAGGACGAGATTGAGC
GTGTTGCCAAGGCTAACCGTTAAGATGGATGTGCATCTGAGGGTCTCGCTTTTGGCTGGAGATTTTGAAGTGAATGTGTTTTACAAGATATCTAGAACTG
TTTTAGCTATGCGTTAAGTTTTATGGAATGAACATTTCGATGTAGTGGCAAGAACGTGCCTGATGCTTGTCTTTGTGAAACCTATTCCTGTTCAGACATA
TTTGGATATGTTGAATGTCGATGTGTTCTGTCATAATATGTCTTGGTTTGATCTAAAAAAAAAA
page-top