Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2472
Contig Information
Length 927 bp
Tissue Shoot grown with cold treatment
Clones 11 Clones [Download: CSV  ,  FASTA ]
whsc2p17    whsc3m17    whsc15d13    whsc17i07    whsc17k17    rwhsc2p17    rwhsc2p18    rwhsc12h12    rwhsc15d13    rwhsc17i07    rwhsc17k17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=HMG1/2-like protein >gi|21803|emb|CAA77641.1| high mobility group protein [Triticum aestivum] >gi|114145392|dbj|BAF30985.1| high mobility globular protein [Triticum aestivum]
Score 359
Evalue 3.03589e-32
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2472
TTTTGGAGGAAACAGCTTAATCTAACATTACCCANACTGATATTATCACAATGTTAGCCGGTGACAATGGACGGAAAGAGTAACCATCTAGGTACAAGCA
GGGGCACCCCGCGGAAGAGGACATACACCCTCCACCACTAGGGCATCCCCGCCGGCGGCGGCGCCAACAGGGAGCGCTATCCGTTATAGCAGGACAATGA
CAGGAAAAAGGTAAAACAACATCACGATGTGAAGTGAAACTTGGGATAATTCTAGTGGAGATGGATAGGCTCCTTATGACACCACCGCACACAGCTCAGG
TCCGTTCTCGCACAGCAGCTCCCGACTTGTCCGCCGGAGCAGCCTTGACAAGATGCGTCTTCTTCACTCGTCATCGTCCTCGTCCTCATCGCTGCCCTCA
TCGTCATCGTCGTCATTGATCTCCGACTTGGACTTGTCAGATTCCTCCTCATCTTCCTCCTCTACCTCCTTGGCCGCAGCCTTCTTTGGGGCAGCAGCAG
CAGCGCTCTCGCCCTTGTTGTAGGCAGCAATGGCCTTGTTGTACTCGCCCTTGAGCTTGTTGGCCTTGGCCACATAGGGGGCCTTTTCCGATTCGCTCAA
GCTCTTCCACCTCTCACCGGCCGCTTTGCCGACGGCGGCGACGGACTTGTTCTTGGGGTTCTTCTGCTTGAACTCCTCGCGGAACTCGCCCATGAAGACG
AAGAAGGCGGATGGCGCCCTCTTGGGCTTGTTGGGGTCCTTGCCGGCCTTGCCCTTCTTCCCCTTGGCGGCCGGCTTCTCCGCCCCCTTGCTCTTCACCG
CCAACTTGGCGTCGGCCTTGGCGGCGCCCTTGGATTTGGCCCCCTTCATGGCTGGTTTCCTGGGGGGAGGGGGCGGGGGAGAGAGGGCGCTCCTGGTCTG
GGTTGGGGAAAGGAGGAGCCTCGTGCC
page-top