Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2469
Contig Information
Length 936 bp
Tissue Shoot grown with cold treatment
Clones 11 Clones [Download: CSV  ,  FASTA ]
whsc1d17    whsc2h21    whsc5e16    whsc5f03    whsc17k09    rwhsc2h21    rwhsc5e16    rwhsc5f03    rwhsc17k09    rwhsc18m24    rwhsc1d17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit S-adenosyl-L-homocysteine hydrolase [Hordeum vulgare subsp. vulgare]
Score 1214
Evalue 2.20956e-131
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2469
TTTTTTTTTTCACTCAAACCAATAATAATGCCATTATTTCTGGGCAAAAGCAAACGCCGCCTCTCCCAACCCTCACAAGGCTCAAAACATAACCATAATA
ACAAATCCTCCGCCTAAGAGACAGCATGTAAGATAATAGAAGGGAAACAGGATAGTTGATAAGAGTTCCCGTTGGTGCCGCTGCTCCGACTCAGGCTCAG
GCCAGCCGCTAGTCGTGCTGGACACACTAGTACCGGTAGGCCGCAGGCTTGTACGGACCCTCAACTGGGATGCTAATGTAGTCAGACTGGGACTTGGTGA
GCTTGGTCAGCCTGGCGCCGAGCTTGCCCAAGTGGAGGGCCGCGACCTTCTCGTCGAGGTGCTTGGGGAGAACGTACACCTTCTTCTCGTACTTGCCAGT
GGCCTTCTCGTTCCACAACTCAAGCTGAGCAATAACCTGGTTGGTGAATGAGCAGGACATGACGAAGCTGGGGTGGCCAGTGGCACATCCAAGGTTCATC
AGACGACCCTCAGCAAGAACAATGATGCCAGTCTTGGTCTCGGGGAAGACCCAGCGGTCAGTCTGGGGCTTGATGGTGATGCGCTTGACACCAGGGTAGG
TCTCAAGGCCGTTCATATCGATCTCATTGTCGAAGTGACCAATGTTGCAGACAATGGCGTTGTTCTTCATCTTCCTCATGTGGTCAACCATGATGATGTC
CTTGTTTCCGGTGGTGGTCACAAAGATATCAGCCTCAGAGACAACATCCTCCAAGGTGAGGATCTGGATGCCCTCCATCAGGGCCTGAAGGGCACAGATG
GGGTCAATCTCTGTCACGATCACACGGGCACCAGCCTGCTTGAGTGCGGCCGCACAGCCCTTGCCAACATCACCATAACCGCAGACCACGGCAACCTTGC
CGGCGATCATAACATCAGTGGCCCTCATAAGACCAT
page-top