Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2453
Contig Information
Length 739 bp
Tissue Shoot grown with cold treatment
Clones 10 Clones [Download: CSV  ,  FASTA ]
whsc1a16    whsc10o07    whsc7c19    whsc7c20    whsc7g22    rwhsc10o07    rwhsc1a16    rwhsc7c19    rwhsc7c20    rwhsc7g22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Histone H2A.2.1
Score 463
Evalue 1.76445e-44
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2453
GCTTCCACCCACTCTCAAACCCTCTCGCCGGAGCCCCCAGCAAGCCAGCAAGCAAGCAAGATGGACGGCAGCAAGGCGAAGAAGGTGGCGGCGAAGAAGT
TCGGCGGGCCGAGGAAGAAGTCGGTGACCAAGTCCATCAAGGCCGGGCTCCAGTTCCCCGTCGGCCGCATCGGGCGCTACCTCAAGAAGGGCCGCTACGC
CCAGCGCGTCGGCTCCGGCGCCCCCGTCTACCTCGCCGCCGTCCTCGAGTACCTCGCAGCAGAGGTGCTGGAGCTGGCCGGGAACGCCGCCAAGGACAAC
AAGAAGACCCGGATCGTGCCCAGGCACCTGCTGCTGGCCATCCGCAACGACCAGGAGCTCGGGAGGCTGCTGAGCGGCGTCACCATCGCCCACGGCGGCG
TGATCCCCAACATCAACCCGGTGCTGCTCCCCAAGAAGGCCGCTGAGAAGGCTGAGAAGGCCGGCGCCGCCCCCAAGTCGCCCAAGAAGACCACCAAGTC
CCCCAAGAAGGCCACCAAGGCCTAGATCCGGCCGTGCCGGTGAACTGATGGTGCTCCGGCAGCCCTCGTGTGCCTAGTGTCTCTGTGTTAAGTTAGCTAT
GGTGTGTTCCAGAGAGTGTTGAAGCTTGTCCTTTTGCTTTGCCCCACCATGTAACCGTGAACGAAGAGGAAGCGTCTTGCTTCCTCTGTTCTTCTGAATC
CATCTGGTGTCTAATGCAGTGTTGTTAAAGTGCCAAAAA
page-top