Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2452
Contig Information
Length 525 bp
Tissue Shoot grown with cold treatment
Clones 10 Clones [Download: CSV  ,  FASTA ]
whsc1f10    whsc17h13    whsc17o02    whsc20k05    whsc9b22    rwhsc17h13    rwhsc17o02    rwhsc1f10    rwhsc20k05    rwhsc9b22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Gamma-2-purothionin >gi|100844|pir||S11530 purothionin gamma - poulard wheat >gi|227203|prf||1616227B purothionin gamma2
Score 266
Evalue 5.39032e-22
Total Hit Count 188
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2452
TTTTTTTTTTATTCATTCATATTATTATNTTGCATGCATCGATCGAGATGCAGCAGCTGGCTAGTGGCGACACGGATATACATACGACATACGTACGTAT
AAGGGGGCACACACACACACACACACATTCAAGTAGGTACACAGACGTATGGCTCCATGGGCTAGCTAGCTGACGTACGGCGAGGGCCAGCTAGCCGTAG
CATTCCACATATGATCAGCACTGCCTGATGCACTTGCACCGGCGGAGGGGCCCGTCGCAGTTGCCGCCGCCCCAGCGTTCCTGCAGGCAGACCTGCGCGC
AGTTCTTGTCCGACACGCATGGCCCCTTGAACCCCGCGCTGCGCTGCCGGCAGATCTTCGCCTCCGCCCCCGGCACCGCCGCCTCCTGTGCGATGAGGAG
GAGAAGCAGGACCAAAACCACCTGCGTCGCCACCTTCTTGGTCCACATGGTGAGCGGCCGGGCTGGGAGCGAGCTAAACTCTGCTTGCGCTACGTACTGG
CTTTGTTACTACCGGTGGAGTTGTG
page-top