Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2439
Contig Information
Length 1285 bp
Tissue Shoot grown with cold treatment
Clones 10 Clones [Download: CSV  ,  FASTA ]
whsc1e03    whsc11b03    whsc16p20    whsc17o07    whsc7a13    rwhsc11b03    rwhsc16d03    rwhsc16p20    rwhsc17o07    rwhsc1e03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_37384 [Oryza sativa Indica Group]
Score 1233
Evalue 2.21673e-133
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2439
TTTTTTTTTTGAAGCACAAAGCAGAGCAATGCATAAGTAACTAAGTGCATAACATAACGTTAACATATTCGAATACACACTAACAAACAGCATAATTAAT
TCTTGTTCAAGGTAATAATAAGACTTGAAAAACTTCAGTGTTCAACACTTAACAAAACTGGCGACTGGACACGGCTTTATGAAGGAAGGCACACAGCTTA
GTCGTCGAACAGGCTGAATCCCATCTCGCCATCTGATTCCTCCTCGGGCTCGTCCTTCTTCTCCTCCTCCTTCGGGGCAGCGGCGGCAGCACCACCGGAG
GCAGCAGCAGCAGGGGCAGCAACGGCAAACTTGCTTGGGTCCTTGAGGTACTCCTTGATCTTATCAGCATGATCATATGAGTAGTCTGTCTCCAAAGCAA
CCGCAAGAACATTCTTGTATGCATTGAGGAACATGTGTGGCGCAGCAGACATGGTGGGGTATGAGATCGCCAGGGACAGTGAGGCAACCATGGACACACC
AGAAGCAAACTTGTCCATCAGGTCTTCCTCGGTGAGGTCAAGAACCTCAGGGCTGAAGACTGACCCGCTGTCATAGACATTGCAGATGACCAGCCCATAA
GAGAAGGGGCGGATACCAAGCTTGGCAAGCAGGGCAGACTCAGAGGAGCCCACCTTGTCACCCTTCTTTATCAGCTCCACAGGGATAGTAATTTCCACAG
TGCCCTTGTTAATCTTGGTGGGAATGTTGAGCACCTGGAAGAAGGACGTCTGGGAGGGATCCAGACCAGTGTTGCCAGGGGGAACCACCACATCAACAGG
TGCAACTAGCCCAACACGAGCAGGAGCACCAACCTTGTACTTGGCGACCTCCTCGCGAACCTCCTTGAGGTCACCCTTGGTGAAGATGAGGCCAACGTTA
CCGACGAGGAGGTTGCTGAGCTCAAGGAAGTCCTTGTTGCCGGTCTTCTCCGAGTGCACCTTGATGCAGCGGCGGATGAGGGTGTTCTTGCCCATGAGCA
CGATGGAGTCACCGCGGAGACCCTTGCGGATCTCCTGGAGCTGCTTGGAGCCGACATTGTCGGCGACGGCGATGAGCACCTTGGTGTACTCCTCGAGCAG
CTGGCAGAGCTTCTGGTCGTACGCGATCTTCTTCTCGGCCTTGGTCCTCTTGATCGCCATCGCAGCAGCTACGAGATGGACGGAGGCGCTAAACCTAGAT
TGCTAAATCTGTGTGGGGGGAGAGAGGCGAGAGGATGAGGACCAGGCTCGGGAGAAGAGCGAGGCGGACGGCTTGCGGCGGCGGC
page-top