Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2437
Contig Information
Length 817 bp
Tissue Shoot grown with cold treatment
Clones 10 Clones [Download: CSV  ,  FASTA ]
whsc5n14    whsc11c01    whsc17c06    whsc17c12    whsc7g05    rwhsc11c01    rwhsc13k02    rwhsc17c06    rwhsc17c12    rwhsc7g05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit meiosis 5 [Zea mays]
Score 540
Evalue 2.48986e-53
Total Hit Count 58
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2437
TTTTTTTTTTAATGGAAAAGGATGGATTTATTGCACTCAAAATGCCATAGATAGTGATATTACATGATAAAACAACAAAAATAAAAGAAATATATCAAGC
CACAAGATAGCATCAATCAAGAAAAATGCGCGGGAGGAAGAAATTTAGCCAAGAAACACCGATGACTGAAACTAGTAGTGGAATTCATTTGCCTTCTTGA
AAACCCCAGCTTGGGCAGAAGCAGCACCATCAGAGGTCACGGCCACGACGATACAGTCCTTCACCTGCTGGGTGGTAAATGGGAACTTCTTGTTCACAAT
GGAGTTGAGGTATGCAGCTGCCCCCTCACGTATCAGGGCGCCAATACCATCAGTTCTAGTGTTTGAGAGTGCATCATGCATATTTCCTAGCTTCTTGCCA
CCTATCATACTGCATGCAGCACCAAATGTCTTGCCGATGTTGCCGAGGGACCCAATAGCTGCAACTATAGCATCTGGGTGATTCTTCCAGTAGTCGCAGG
ATCCAATGAACCCATGCTTCTTTGGACTTGCAGGGACATCATGGGAAGGTGCACTTGGGGTGCTCGGTGTAGTGCCATAAGATGGCGTCGGTGTAGTGCC
GTAAGATGGCGTCGGTGTAGTGCCGTAAGTTGGCGTCGGTGTAATGCCGTAAGTTGGTGTCGGTGTAGTGCCGTAAGATGGCGTCGGTGTAGTGCCGTAA
GTTGGTGTCGGTGTCAGTGTCGGGTTGTAGCCTCCTCCTGACCCATGCGTGGGAGTTGGTGAGCCCCCATAGTGGGTCTTCTGCTCATGCAACTCTCCCA
GGCTCCTGCACGAGCTC
page-top