Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2431
Contig Information
Length 1882 bp
Tissue Shoot grown with cold treatment
Clones 9 Clones [Download: CSV  ,  FASTA ]
whsc1b03    whsc1h09    whsc15i15    whsc15n03    whsc9l05    rwhsc15i15    rwhsc15n03    rwhsc1h09    rwhsc9l05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0614600 [Oryza sativa (japonica cultivar-group)] >gi|33340007|gb|AAQ14479.1|AF297651_1 putative aminotransferase [Oryza sativa] >gi|38344251|emb|CAE04333.2| OSJNBa0008M17.4 [Oryza sativa (japonica cultivar-group)] >gi|113565434|dbj|BAF15777.1| Os04g0614600 [Oryza sativa (japonica cultivar-group)] >gi|215717129|dbj|BAG95492.1| unnamed protein product [Oryza sativa Japonica Group]
Score 2363
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2431
CCTCTCGCTCTGTATCTCTCCTCTCCGACGGAAACAGCCATCTCTGATCCTCCTGTGTGGCCGCCGAGATGATTGCGCGCGGCCTGCTCCGATCCAATTC
CTCAACGCAGGCAAGCAAATTAGTGAAGTATTTAACCAGCGCCGGGAGCTTACAAGGGCATGCAGAGAGCTTGTCAGATGCATCGGTCAGACATTTCAGT
TCAGCGTCGTCTCCTCAGACTAACTCAACTGAAGAAAATGGGTTTAAGGGGCATGGCATGTTGGCACCATTCACAGCTGGATGGCAGAGCAATGATGTGC
ATCCGCTGGTTATTGACAGATCTGAGGGGTCTTATGTTTATGACATCAACGGGAATAAGTATCTAGATTCTCTAGCAGGACTCTGGTGTACAGCTTTAGG
TGGTAGTGAGCCTCGATTAGTCAAAGCTGCAACTGACCAATTAAACAAGTTGCCCTTCTATCACTCCTTCTGGAACCGTACAACCAAACCAACATTGGAT
CTTGCAGACGACCTTCTTAGCATGTTTACTGCAAGCAAAATGGGAAAGGCATTCTTCACAAATAGCGGTTCGGAAGCAAATGACTCACATGTCAAACTAG
TATGGTATTATAACAACGCATTGGGGAGGCCAAACAAGAAAAAGTTTATTGCACGATCAAAAGCATATCACGGATCAACATTAATATCAGCTAGTCTCAC
TGGTCTTCCTGCTCTGCACCAGAAGTTCGATCTACCAGCACCTTTTGTTCTGCACACAGACTGCCCTCACTACTGGCGCTTCCATCTTCCTGGTGAGACA
GAAGAAGAATTTGCAACAAGACTTGCCAAAAATTTAGAGGATCTTATCCTCAAGGAAGGACCAGAAACAATTGCTGCGTTCATTGCTGAGCCTGTCATGG
GTGCTGGTGGTGTCATCCCTCCTCCAAAGACCTATTTTGATAAGGTTCAAGCTGTGGTTAAGAAGTATGACATCCTTTTCATAGTAGATGAGGTCATTAC
CGCATTTGGAAGGTTGGGAACCATGTTCGGATCTGATATGTATAACATCAAGCCAGATTTAGTCACCTTGGCCAAGGCTCTTTCGTCTGCGTATGTGCCC
ATTGGAGCAACTCTTGTTAGCCCCGAAATAGCAGCTGTGGTTGATTCTCAGAGCAATAAGCTAGGTTCATTTGCTCATGGCTTTACATACTCTGGCCATC
CAGTTGCTTGTGCTGTTGCCATTGAAGCGTTGAAAATCTATCGGGAAAGGAATATTCCTGATCATGTGAAGCAAATTGCTCCACGCTTCCAGGAAGGATT
GAAGGCCTTTGCAGGAAGCCCAATTGTTGGGGAGATCCGTGGTGTAGGGTTGATAATTGGAACTGAATTCACCGACAACAAATCACGAGATAGCCCATTC
CCTGCTGAATGGGGTGTTGGTGCTATCTTCGGACAGGAGTGCCAGAAGCGTGGCATGCTGGTTAGGGTTGCCGGCGATAGCATTATGATGTCACCGCCAT
TAACAATGACCGCTGGCGAAGTTGAGGAGCTGGTGAGCATATACGGAGAAGCTATGAAGTCCACGGAGATGAAAGTGGCGGAGCTCAAATCGAAGAAAAA
CTAGACAAGATGCAGCACAACGACGATGATAATGTCGACTGCGGCGTTGGTCTCGGATGTGTACAGAATAATTCCTCGCTATCAGGTGGTAATAACGCAC
CGGAACGGACGCTGTTCTTGATGCGCGGAATGGCAAGGCAAAGCATTCTTTCACCGAGCAATGGTGATTGACGACTTGATTACAGACAAGATAGATTTGG
CACATTCTTACCTGTAAAGATAATTTGCCAAATAAAGCCGTTTATAAGCTTTGCCACTTTGATAATCTCTTGTACTGACACA
page-top