Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2383
Contig Information
Length 663 bp
Tissue Shoot grown with cold treatment
Clones 8 Clones [Download: CSV  ,  FASTA ]
whsc10n14    whsc18f04    whsc8j01    rwhsc10e06    rwhsc10n14    rwhsc14e01    rwhsc18f04    rwhsc8j01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Chain 4, Structure Of Signal Recognition Particle Receptor (Sr) In Complex With Signal Recognition Particle (Srp) And Ribosome Nascent Chain Complex >gi|119390381|pdb|2J37|4 Chain 4, Model Of Mammalian Srp Bound To 80s Rncs
Score 517
Evalue 7.67941e-51
Total Hit Count 451
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2383
AGCATCAACACAAGTCACTTCGATTGCATCAAATTCATGAAAGTGTGCAGCGATATGGTAGGCAATGGAGCCACTAAGGCCCTTTGCTAAGTAACAACTA
CAAAATTCCAATAACATAAGAAACCACGACACAAGCGCCTACTGCAGGACCCTCCCTCTGGCTTATATGATGCCGATCTTGTTGGCCACGTCAAGAGCAT
CGTAGTCTGGTGTCAGCTTCACGTACGCCTTCTTCTTGCCATCAGGCCTGATGAGGGTGTTAACCTTCTTGGCCTGAATGTCATACATTTTCTTGACAGC
AGCCTTTATTTTCTTCTTGTCGGCCTTGAGGTCGACAATGAAGACAAGGGTGTTGTTGTCTTCAATCTTCTTCATCGCAGACTCAGTGGTAAGCGGGTAC
TTGAGGATCTGGTACTGGTCTAATTTGTTCCTTCCAGGGGTGCTGATCCTGGGGTACTTGGGGTCCCTGGCCTTGGACAGGGTCTTGGGGCGGTGAAATG
TCACAGAAGTGCGGATCTTCTTTGCCGTCTTCTTGATTGACCCAGACTTCACAGCCTTGGCAACCTTGGCGGCCTGGGCCTTGGCATCGCCCTTCTTGGC
AACAGCAACTTTGGGAGCCATTTGAGCTTCTCAGAAAAGCCTCTTGAACTTACCTTCCTGGGG
page-top