Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2378
Contig Information
Length 1536 bp
Tissue Shoot grown with cold treatment
Clones 8 Clones [Download: CSV  ,  FASTA ]
whsc1a07    whsc1a08    whsc2e19    whsc10e16    whsc18b11    rwhsc18b11    rwhsc1a07    rwhsc1a08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein NitaMp027 [Nicotiana tabacum] >gi|57014030|ref|YP_173501.1| hypothetical protein NitaMp164 [Nicotiana tabacum] >gi|56806536|dbj|BAD83437.1| hypothetical protein [Nicotiana tabacum] >gi|56806666|dbj|BAD83567.1| hypothetical protein [Nicotiana tabacum]
Score 271
Evalue 1.15764e-27
Total Hit Count 66
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2378
CGGGCATTGAGAAGGAAGGACGCTTTCAGAGGCGAAAGGCCATGGGGAGAGATTTTTCTGTGATCCATGGATCTCCGATCGGGAAACCGTATCCAAGCTC
CGTGGCTAGTCTGCGCTCTTTGGACTTTTCAAACTTAGCGAACTGAAACATCTGAGTAGCTAAAGGAAGGAAAATCAACCGAGACCCCGTTAGTAGCGGC
GAGCGAGAGCGGAACAAGGGTTTTCATCAAAAGAAATCCGAAGCGGTTTCATTCGATTTGTTGTGGATTGGATGATGGAAAAACCAGCAAGCAGCAAGCG
TAGTTAGAAAAGTTGCCGTAGCGCGCCCTACGGAGTTGTACAAAGTCAGCAACCGTTTTGGGGCGCAAGCATAGGCAACACAGGACTGATGACGGGGTGG
GGCGCGCAGTGAACTGGTTTTCTAAAAAGATTGGAAGATCCGGCCAAAGAAGGTGATAGCCCTGTTCATTCGTTCCCATGGTTCGATCCTTCCCAGTAAA
ACGCGGCGTGTTCGAATGATGATCGCTTTTACGCGAGAAAGGGGGACCACCCTCTAAGCCTAAGTATTCCTCAATGACCGATAGCGTACAAGTACCGTGA
GGGAAAGGTGAAAAGAACCCCAATCGGGGAGTGCAATAGAGAACCTGAGATCCGATGCGAACAATCAGTCGAAGGAGCGGAGCGCGGGCGCACTCACTCT
AACGGCGTACCTTTCGCATGATGGGTCAGCGAGGAAATGGGAACAGCGGCTTAAGCCATTAGGTGTAGGCGCTTTCCAGAGGTGGAAGATTTACGTTCTT
CCTATTTGACCCGAAACCGATCGATCTAGCCATGAGCAGGTTGAAGAGAGCTCTAACAGGCCTTGGAGGACCGAACCCACGTATGTGGCAAAATACGGGG
ATGACTTGTGGCTAGGGGTGAAAGGCCAACCAAGATCGGATATAGCTGGTTTTCCGCGAAATCTATTTCAGTAGAGCGTATGATGTCGATGGCCCGAGGT
AGAGCACTCAATGGGCTAGGGTGGCCCCCATTTCGCTTTACCAACCCCAGGGAAACTCCGAATACAGGCCGTCATCCTTAGTACAGACAGACTGATTGGG
TGCTAAGATCCAAAGTCGAGAGGGAAACAGCCCAGATCGTACGCTAAGGTCCCTAAGCAATCACTTAGTGGAAAAGGAAGTGATCGAGCGATGACAACCA
GGAGGTGGGCTTGGAAGCAGCCATCCTTTGAAGAAAGCGTAATAGCTCACTGGTCTAGCTCCATGGCNCCGAAAATGTCTCAGGGCTCAAGTGATTCNCT
GAAGCGACGAGACCTTGAAAGCAGCTTTTTCAAGTGTCAGTAGCGGGACGTTCTGTCAATCGGGGAAGGTTTTTGGTGACAAGACCTGGAGATATCAGAA
GTGAGAATGCTGACATGAGTAACGAGAAATCCTGTGAAAAACNCGATCGCCTGCCAGTGGAAGGCTTTCTGCGTTCAGTCAATCTACGCAGAGTGAATCG
GTCCCTAAGGAACCCCCGAAAGGGCTGCCGTCCGAT
page-top