Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2372
Contig Information
Length 721 bp
Tissue Shoot grown with cold treatment
Clones 8 Clones [Download: CSV  ,  FASTA ]
whsc1f21    whsc1f22    whsc16k02    whsc9o10    rwhsc16k02    rwhsc1f21    rwhsc1f22    rwhsc9o10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Histone H2B.2
Score 528
Evalue 4.81011e-52
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2372
TTAGATGTAGTAGTACCACAACCGCAACATTTTCTAGATAGATTTCATTTTGCAAAAGCAACACGTTCAGTTCTCACAACCAAGAAGCCAACAAAGCGTT
GGCAATCTTCTACCACACGAACTACTACCACTACTTCTACTTGCAGGTAAGCAGAGTCAACAGCAGAGATACATCAGACAGCCACATCTGGCACAACAAG
CGGCGCATCTTCAGTCTAGGAGGAGGTGAACTTGGTGACGGCCTTGGTGCCCTCGGAGACGGCGTGCTTGGCGAGCTCCCCGGGGAGGACGAGGCGGACG
GAGGTCTGGATCTCCCGGGAGGTGATGGTGGGCTTCTTGTTGTAGCGGGCGAGCTTGGCCGACTCCCCGGCGAGCTTCTCGAAGATGTCGTTGATGAAGG
AGTTCATGATGGACATGGCCTTGGAGGAGATGCCGATGTCGGGGTGCACCTGCTTCAGCACCTTGAAGATGTAGATCTTGTACGTCTCCACGCCCTTCTT
GGCCTTGCTGCCCTTCTTGCGGCCCCGGGTCTTGCCCTCGCCGCCGGCCTCCTTGGACGCCGTCTTGCCCGCCGGCAGCCGCTTCTCGGCCTTGGGCTTC
TTGCCCGCGGGGGTCTTCTCCGCCGCCTTCTCGACCTTGTTCTCGGCGGCCGGCTTCTTGTCTGCCTTGGGGGCCATGGCTGCCGCTTCGGGTGGGGTTG
GGAGCTTCGGTGGTGGGATGC
page-top