Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2360
Contig Information
Length 722 bp
Tissue Shoot grown with cold treatment
Clones 7 Clones [Download: CSV  ,  FASTA ]
whsc16l03    whsc18m17    whsc19g17    whsc6p20    rwhsc6p20    rwhsc18m17    rwhsc19g17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit lipid transfer protein [Triticum aestivum] >gi|94315725|gb|ABF14725.1| non-specific lipid transfer protein 1 precursor [Triticum aestivum]
Score 394
Evalue 1.67628e-36
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2360
CGAATTCGGCACGAGGAAGCAAATCTAGCCCATCTCACCATCTCCAGCTGAGCTCAACACCACTACTACTGCAAACTCGATAGGGATGGCTCGCGGTGCA
GCTACTCAGCTCGTGCTGGTCGCCATGGTGGCCGCTATGCTCCTCGTAGCCTCCGATGCGGCGATATCCTGCGGTCAGGTGACCTCTGCCTTGAGCCCCT
GCATCTCCTATGCACGCGGCAACGGCGCCAACCCGCCTGCGGCCTGCTGCAGCGGCGTCAGGAGTCTGGCCGGTGCAGCCCGGAGCACCGCTGACAAGCA
AGCAGCGTGCAAGTGCATCAAGAGCGCTGCTGGTGGGCTCAACGCTGGCAAGGCCGCCGGCATCCCTTCAAAGTGCAGCGTCAGCGTCCCCTACGCCATC
AGCTCATCTGTGGACTGTTCTAAGATTCGCTGATCGACCACTTCTTCTCATCGTCGCTGCATATAGCTCGAGCGATCTACGTTGAGTACGTTGAGGTCAT
ACACATACATATACATATATATGAATAAGTGCTCTCATATTATCTCACTGCGTGAGAGCGAGAGGAGTACCTACGTCCGGCCAGCTCTGCATGGCAGGCC
ACACTGTTATATTGATGTTTGGTTGTTCCTTCACCCCTTTTGAGAGGACTCATGAGTTTATTCTTCTTTGTACCGTGTGCACTTTTGATATATGGACCTT
ATACTCANCTCTAAAAAAAAAA
page-top