Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2359
Contig Information
Length 675 bp
Tissue Shoot grown with cold treatment
Clones 7 Clones [Download: CSV  ,  FASTA ]
whsc1b20    whsc18m07    whsc18m08    rwhsc18m07    rwhsc18m08    rwhsc18m19    rwhsc1b20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 40S ribosomal protein S26 [Zea mays]
Score 365
Evalue 3.3839e-33
Total Hit Count 297
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2359
TGATATAGATAGCAGNGAAATTGTCAAAACATAAAGACCTGATCACAAATTGTGCTTGACCAACCAACTTTCAGTACAACCGATTGCAGCAAAAACTAGG
TAGAATAGTTCAATATCCAGGGACGAGTAAAACTAGGGCTGGCTCCATATCACGGAAGCATTCCCAAACTAGACACGGGGAGCAGGAGCACCAGGAACGG
CACCAGCGCCAGCAGGCGCGCCACCAGGTCCACCAGCACGGGGCGGGCCACCCTGTCCAGGCCTCGGGCCATCATCCCTGCGCCTGAAACGCTGCGGGGG
CTCACGGTTCCTCCTGTTCTCACGCGAGCGGACACGGACAATGTGGGCATGGATGGCACAAGACACACAGTGGTGCACCTTGGCGTACAGCTTGGGAAGC
ACATATCCATCATGCACACAAGCCTCCTGCACATCTCTCACAGCAGCCTGCTCCACGATGTTCCTCACCAAGAAACGCTTGATAGCCTTGTCCTTGGGGC
AGCACTTGGCGCAGTTGGAGCAGCGGATGTACTTGACGTGGCCGCGGCCATGCTTGTTGCGCCCGCCGTTCCTCCGCTTGAACGTCATGGTCGCTTCGCG
CCGCTAGGCGGGGGGTGGAGGCGCCCGGGAGAGGGGAGGAGGGAGGCGAGGCTCTAGGGTTGCCTCGTGCCGAAT
page-top