Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2354
Contig Information
Length 1231 bp
Tissue Shoot grown with cold treatment
Clones 7 Clones [Download: CSV  ,  FASTA ]
whsc4l05    whsc15e10    whsc19h04    rwhsc4l05    rwhsc15e10    rwhsc19h04    rwhsc1f09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cytosolic malate dehydrogenase [Triticum aestivum]
Score 1636
Evalue 3.89909e-180
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2354
ACTGTCCTGTAATCATCAGGCAAAAGGGGAGCTACAAGCCTCATTCATACACACTTGGAAAACCAGCGAAAAGGAGCATGCATCGCGATGTGCGGCTGTT
CTGGGTGGAGACGAGAGTTTCTAAAGAGCGGAAGGTTTCATTTATTCAAAACATCCAGAGGAGCAGCTGCCCTTCGAATGTGGATTTACGCCAGGCATGA
GTAGGCCAACGCCTTCTCCTCTGACAGCTCCTGGGCGGTCGCATCCATCTTCTTCCTCGAGAACTCATCGATCGGGAGCCCTTGAACAATTGTCCATTCA
CCACCACTGCACGTTACTGGGAAGGAGTAGATAAGACCAGCAGGCACACCGTATGAACCATCAGAGTACACACCCATGGAAACAAATGTTCCCTCAGCGG
TTCCCAGAACCCAGTCACGGATGTGATCACAAGCTGAGCTGGCAGCAGAGAGAGCACTGGAGAGCTTCCTCGCTTTGATGATTGCAGCACCACGCTGCTG
GACAGTGGCAATGAACTCCCCATTTAGCCATTCATCATCTTGAACAAGTTCACGAACAGGCTTCTCTCCACTGGGAGTCTTCACAGTGGCATGGTTAACA
TCAGGATACTGACTGGACGAGTGATTACCCCAGATAATAGCATTCTTAACGTCAGAAACTTGGACACCAAGTCTCTCAGAAATCTGACCGAGTGCCCTGT
TGTGGTCTAGGCGGGTCAAACAACTGATGTTCTTCTCAGGGATAGATGGAGCAAACTCCTTCAGGATGAGAGCATTGGTGTTTGCTGGGTTGGCAACAAC
CAAAACCTTGCAATTGGGGGCTGCATGAGCTTCAAGAGCAGATGCTTGAGCTTTGTAGATTGAAACATTTTTCGTCATAACATCCTTCCTTTCCATTCCT
TCCTTCCTGGGGAATCCACCAACCATAACCGCAACATTCACACCAGTGCAAGCCTCAACAACATCAGTTGTTGCAACAACTCCCTTGAGAAGTGGAAATG
CGGCATCGATCAACTCCATCTTGACGCCTTTAAGAGCTTCAGCAGCAAATTCAATATCCAGCATATGCAGAATAACAGGCTGGTCTGCACCAAGCATAAC
TCCCCTGGCAATCATGGGAACAAGAGCATATCCGATTTGTCCTGCGGCGCCGGTGACGAGCACGCGCATCGGTTCCTTCGCCGCCATTGGAGCCGGGGGG
TAGATTCTGGACACGGGGATAGGGAGAGTGG
page-top