Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2347
Contig Information
Length 739 bp
Tissue Shoot grown with cold treatment
Clones 7 Clones [Download: CSV  ,  FASTA ]
whsc1g09    whsc18n17    whsc7o20    rwhsc18n17    rwhsc1g09    rwhsc7o20    rwhsc7p07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_13062 [Oryza sativa Indica Group]
Score 367
Evalue 2.39027e-33
Total Hit Count 61
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2347
TTTTTTTTTTATTTAAACTCCATATTTATAAACCTGGTGCCATGAAGGTAGATCCAACATCAATACAAGGAAATACTCCCAAGACAACAGAGACCACAAA
CTAGGGTAGGTAATAGACATAAGCTGTGGCATAGGTTCATAATATTGCCAATGAATTATTTAGGAGATATATATCATCATCATCATGACTGAAAACAGGC
TCCGACCAATTAAGCCCCAATCAAGCAAAGATAGTAGCTTAAAGAGTTGCACCAGCTCCTGCTCCTCCACGGCGGCACTCGTTCAGCATGTCGAGGTAGA
ACTGGCACTTGCTGATGTCGCTGCCGTAGTGGTTGATGCAATCTTGGAAGGCCTTGGAAGGGTTGCCACACTTGTCATCAGCAGCGTTGTCCATTGGAGT
CATAGATGCAGCAGCCTCACCGACAACAGTCTCATGCTGAATGGTACGGGGACCCATCACAGCATCAACAGCCCTGTGCGCCATAGCACTGCCAGTACCA
AAAGCCATGCCCTGAGCAATAGTGGACCCAATTCCGCTCATGATACCACCACCGCTGCTCTGGGTAGTAGCAGGTGGAGGAGCTTGACGGGCTGGCGCTG
GTGGGTTTCTCACTGGAGCAGCACGTGGAGCAGGGCGGGAAGATCTTCCTCCTCCGCTGCGGCGAGCCATGGCGGCGGGTGTGGCGGACGGCGGGAGGAA
ACCCTAGGCTGGAGGCGGCGGCGGGAGGGGGGAGCGGAT
page-top