Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2342
Contig Information
Length 855 bp
Tissue Shoot grown with cold treatment
Clones 7 Clones [Download: CSV  ,  FASTA ]
whsc1d03    whsc18o14    rwhsc3n24    rwhsc13a15    rwhsc18k20    rwhsc18o14    rwhsc1d03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Elongation factor 1-alpha; Short=EF-1-alpha >gi|170776|gb|AAA34306.1| translation elongation factor 1 alpha-subunit >gi|949878|emb|CAA90651.1| elongation factor 1-alpha [Hordeum vulgare subsp. vulgare]
Score 897
Evalue 1.08548e-94
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2342
CCATAGTATGATAGCAGAGTACTAGCAAATGGGAAAGCAGGTTCTAGTACTAGCATTCACCACAGGAAAACAAAACCACAAATGGGATAAGAGCACAATA
ATGGAATCGAAATAGAGTATTTAAACGACACATCATAGCTCGCACACAGGTGCAGGAGTCAAAGTGCAATAACGCCCAGGAACACTTAACATACACTAAG
ATTCTCCAAAAAAGACTTGACACTAAAACTTCTGCTAGATAACTCGATGGCAGACACCAGAGCACTCATTTCTTCTTGATGGCGGCCTTGGTAACCTTGG
CACCGGTGGGGTCCTTCTTCTCCACGCCCTTGATGACACCAACAGCAACCGTTTGTCTCATGTCACGCACAGCGAAGCGGCCAAGAGGAGGGTAGGTGGC
GAAGGTCTCCACAACCATGGGCTTGGTGGGAATCATCTTCACGATACCAGCGTCACCGTTCTTCAGGAACTTGGGCAGCGCCTCCAGCTCCTTACCAGAT
CGCCTGTCGATCTTGGTCACCAGCTCGGCGAACTTGACAGCAATGTGGGAGGTGTGGCAGTCCAACACTGGGGCGTAGCCGTTGCCGATCTGACCAGGGT
GGTTCATGATGATGACCTGGGAGGTGAAGTTGGCCGCTTCCTTGGCAGGGTCATCCTTGGAGTTGGATGCAACAAAGCCACGCTTCANATCCTTCACAGC
AACGTTCTTGACGTTGAANCCGACGTTGTCACCANGAAGCGCCTCCAGGAGAGACTCGTGGTGCATCTCAACANACTTGACCTCANTTGTCANACCANTG
GGACCAAAGGTAACAACCATACCANGCTTGATGACACCANTCTCAACACGGCCAA
page-top