Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2345
Contig Information
Length 560 bp
Tissue Shoot grown with cold treatment
Clones 7 Clones [Download: CSV  ,  FASTA ]
whsc1d08    whsc1d19    whsc3h22    rwhsc2c20    rwhsc3h22    rwhsc1d08    rwhsc1d19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Histone H2B.1 >gi|21801|emb|CAA42530.1| histone H2B [Triticum aestivum]
Score 456
Evalue 5.97767e-44
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2345
TTTTTTTTTTGCATTGGCAATGATTCGGCAATTTTCATCCAACAGTAGGACTAATATTACTTGCAGATAACCAGAGTCCACAGACAAGCACTAAACCAAC
AGGAAGGAACTGCATTTGCTACTAGATACAGGCGACGCAATCTAAGAGGAGGTGAACTTGGTGACGGCCTTGGTGCCCTCAGAGACGGCGTGCTTGGCGA
GCTCCCCGGGGAGGACGAGGCGGACGGAGGTCTGGATCTCCCGGGAGGTGATGGTGGGCTTCTTGTTGTAGCGGGCGAGCTTGGAGGCCTCCCCGGCGAG
CTTCTCGAAGATGTCGTTGATGAAGGAGTTCATGATGGACATGGCCTTGGAGGAGATGCCGATGTCGGGGTGCACCTGCTTCAGCACCTTGAAGATGTAG
ATTTTGTAGGTCTCGACGCTCTTCTTGCTCTTCTTCTTGCCCTTCTTCTCGCCGCCCTCCTTGGAGGCGGTCTTGCCGGCTGGCAGCCGCTTCTCGGCCT
TGGGCTTCTTCGCCGCCGGGGCCTTCTCGGCCTTCTCCGCCGCGGGCTCCTCCTCCGCGG
page-top