Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2311
Contig Information
Length 1453 bp
Tissue Shoot grown with cold treatment
Clones 7 Clones [Download: CSV  ,  FASTA ]
whsc1b23    whsc4n05    whsc5c15    whsc14h22    whsc6l24    rwhsc5c15    rwhsc6l24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit elongation factor 1-gamma [Oryza sativa Japonica Group]
Score 1548
Evalue 7.83763e-170
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2311
TTTCCGCCGCGATCTCGTCTCGCTACGCACTCTCTATCTGAGATTTGGAATCGGGCGAGGCCTGCAGCTCCTGCCGACATGGCGCTCGTTTTGCATTCGG
GCAGTGGCAACAAGAATGCCTTCAAGGCACTTATTGCTGCAGAGTACTGTGGGGTCAAGGTTGAGCTGACCAAGAATTTTGAGATGGGTGTCTCAAACAA
AACCCCTGAATTCATCAAGATGAACCCCCTTGGCAAGGTTCCTGTTCTTGAGACTCCTGATGGTGCTGTTTTTGAGAGCAATGCTATTGCACGCTATGTT
GCCCGCTCAAAGGGTGACAGCCTGCTTTGGGGTGGTTCTCTTATTGAATATGCGCGTGTTGAGCAATGGATGGACTTTGGTGCCACAGAGGTTGATCCCA
ATATCGCAAGGTGGCTGTACCCAAGGCTTGGTTATATGCCTTACAATGCCCAGTCTGAGGAATTCGGCATTGCTGGATTAAAGAGGGCGCTTGAAGCATT
GAACACACACCTGGCATCAAACACATTCCTTGTTGGGCATTCTGTCACTCTGGCTGATATTGTCATTACATGCAACCTCTACCATGGTTTTGCTCGGATC
TTGACCAAGACTTTCACATCTGAGTTCCCTCATGTTGAGAGGTACTTCTGGACCATGGTTAACCAGCCTAACTTCAAGAAGGTCATTGGCGAATTCAAGC
AGGCAGAGGTTGTACCTCCTGTTCAGAAGAAGGCTGCTCCTGCTAAACAAAAGGAGGCCAAGAAAGAGGCTCCCAAGGCGGCCCCAAAGCCAGCAGTAGT
TGAGGCACCAGAGGAAGAGGCACCAAAGCCTAAGCCCAAAAATCCCCTTGATCTACTGCCACCAAGCAAGATGGTACTTGATGACTGGAAGAGGCTATAC
TCAAACACTAAGAGCAACTTCCATGATGTTGCTGTTAAAGGTTTCTGGGAGATGTATGACCCAGAGGGCTACTCTCTGTGGTTCTGTGACTACAAGTACC
AGGAAGAGAACACCGTGTCGTACGTGACCCTGAACAAGGTCGGCGGGTTCCTGCAGCGGATGGATCTGTGCCGCAAGTATGCTTTTGGCAAGATGCTCGT
GATTGGTTCTGAGGCGCCCTTCAAGGTCAAGGGGCTGTGGCTCTTCCGTGGGCAGGACATCCCTGAGTTCGTCATGAAGGAGGTCTATGACATGGAGCTC
TACGAGTGGACCAAGGTTGACCTCTCTGACGAGGCCCAGAAGAAGCGCGTGGAAGCCATGATCGAGGACCTTGAGCCGTTCGAGGGGCAGGCCTTGCTGG
ACGCCAAGTGCTTCAAGTAAGCGGAGCAGTGCTTGGGATCGTGACGGTGGCAAAGAACCTATCTAGGACTTGAAATTCAGTGTCGAAACAGTTGGTCTTT
TTTTGGAATAGTTTGCTTGTTACTTAATGGCTATTTGACCCTGGTGAACTAGT
page-top