Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2299
Contig Information
Length 413 bp
Tissue Shoot grown with cold treatment
Clones 6 Clones [Download: CSV  ,  FASTA ]
whsc1b09    whsc4e24    whsc4f24    whsc13a13    rwhsc4e24    rwhsc4f24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit similar to Dictyostelium discoideum (Slime mold). Phosphatidylinositol 3-kinase 3 (EC 2.7.1.137) (PI3-kinase) (PtdIns-3-kinase) (PI3K) (Fragment)
Score 75
Evalue 5.97761
Total Hit Count 3
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2299
GGTTCGTCCACACACTCCCGCCGCCACCACCGCCGCGAACCGGAGAGCGAGGCCGACACCGCCGCCGCGATGAGGGCCAAGTGGAAGAAGAAGAGGATGA
GGAGGCTCAAGAGGAAGCGCCGAAAGATGAGGCAGCGATCCAAGTAGGCCGTAAGCATCATCTTGCATCCAGGCAGCGGAACTCTGAGGGGTGATGGCAT
TGTCTAGTGATTCTTGATTTGTTCTGTTGTTTTGGCTGTGGAAGTTGCTTTTACCTGTGTTTGGTCAAATTTAGTTGTTTAATACTAGTCTGGCTATGTT
CCAGTACTGAGTTTTATGTAATGTGAGGATTATATGTGTTTGTGACTGAATTTTATGCACCTATTATCCTTGAGGTACTCTGAAATGTGCCTTTTGGCCC
TGCAAAAAAAAAA
page-top