Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2287
Contig Information
Length 842 bp
Tissue Shoot grown with cold treatment
Clones 6 Clones [Download: CSV  ,  FASTA ]
whsc1c19    whsc2l20    whsc16b08    whsc8k05    rwhsc2l20    rwhsc1c19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit superoxide dismutase4 [Zea mays] >gi|134597|sp|P23345|SODC4_MAIZE RecName: Full=Superoxide dismutase [Cu-Zn] 4A >gi|6018682|emb|CAB57992.1| superoxide dismutase-4AP [Zea mays]
Score 709
Evalue 6.6651e-73
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2287
GGCATCATCCATCCCATCCCCAGGTCATAAACCCAAGTCGGACTCGCCTTCCTCCTCGCCAACTACTCCTCTCCTCTCCTCCGCGCATCGCACCGGGGTC
ACCTGAGATCACACACACAATGGTGAAGGCTGTGGCTGTGCTTACCGGCAGTGAGGGTGTCAAGGGCACCATCTTCTTCACCCAGGAGGGAGAGGGCCCG
ACCACCGTGACGGGAAGTGTCACCGGACTCAAGGAAGGGCTCCACGGCTTCCATGTGCACGCTCTTGGCGACACCACCAATGGCTGCATGTCAACTGGAC
CACACTTCAACCCCGCTGGTCATGTGCATGGGGCACCCGAAGATGAAATCCGCCATGCTGGTGATCTTGGAAATGTGACAGCTGGAGTGGATGGTGTTGC
TAGCATCAATATTACTGACTGCCATATCCCCCTTACTGGACCAAATTCAATTGTTGGCCGTGCTGTTGTCGTCCATGGTGATGCTGATGATCTTGGCAAG
GGTGGACATGAGCTGAGCAAGAGCACTGGAAACGCTGGTGCACGTGTTGCTTGCGGAATCATCGGGCTCCAGGGCTAAGATGTCATCTTCGCCGACCAAC
GTCGCACAGATATGGGAACCTTTTCAGAATGCAGATTTGCAATCTCTATTCTAAATAAGCACATGATCTTTGATCACTTGTTAGTGTGCACCAGTCGTGT
CAATTCCTATGTGTTACTCTGAACTTTATCGCTGTCATTTGGCTATCGAGATGTGTGACTGGAACAGTTCTGTCAAGTGCTTGTGGATCTGTTGTTCGCT
ACTAGCTCTGGACGTGTTTACAGAAAACGAGAGAGTTCAGAT
page-top