Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2272
Contig Information
Length 898 bp
Tissue Shoot grown with cold treatment
Clones 6 Clones [Download: CSV  ,  FASTA ]
whsc1c14    whsc14a14    whsc14h15    rwhsc14a14    rwhsc14h15    rwhsc1c14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0558600 [Oryza sativa (japonica cultivar-group)] >gi|109940139|sp|P40392|RIC1_ORYSJ RecName: Full=Ras-related protein RIC1 >gi|57899331|dbj|BAD87942.1| Ras-related protein RIC1 [Oryza sativa Japonica Group] >gi|57900421|dbj|BAD87657.1| Ras-related protein RIC1 [Oryza sativa Japonica Group] >gi|113532867|dbj|BAF05250.1| Os01g0558600 [Oryza sativa (japonica cultivar-group)] >gi|125526416|gb|EAY74530.1| hypothetical protein OsI_02420 [Oryza sativa Indica Group] >gi|125570818|gb|EAZ12333.1| hypothetical protein OsJ_002158 [Oryza sativa (japonica cultivar-group)] >gi|215769435|dbj|BAH01664.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1007
Evalue 2.07414e-107
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2272
CCTTCGCCTCCCGGGAAATCGCCTGCCGCCTCGTCTCCTAGAAACTCGCCGCCTCCGTCCGCTGCCATGAATCCCGAATATGACTACCTCTTCAAGCTGC
TGCTCATTGGGGACTCGGGCGTGGGGAAGTCTTGCCTGCTGCTGAGGTTTGCGGATGATTCATATCTGGAGAGCTATATCAGTACTATTGGTGTTGACTT
CAAAATCCGCACCGTTGAGCAAGATGGGAAGACGATAAAGCTGCAAATTTGGGATACTGCTGGACAAGAGCGATTTAGTACCATCACAAGCAGCTACTAC
CGCGGTGCCCATGGCATCATTGTTGTGTATGATGTGACTGACCAGGAGAGCTTCAACAACGTCAAACAGTGGCTTAATGAAATCGACAGGTACGCTAGTG
AAAATGTGAACAAGCTTTTGGTGGGGAACAAGTGCGATCTAGCTGAGAGCAGAGTGGTTTCTTACGAGGCTGGCAAGGCCCTTGCCGATGAGATTGGAAT
ACCATTCCTGGAAACCAGTGCCAAGGATGCAACAAATGTGGAAAAGGCATTTATGACCATGGCCGCAGAGATAAAGAACAGGATGGCAAGCCAGCCTGCT
GGAAATGCCAGCAAGCCTGCCACCGTGCAAATGCGGGGTCAGCCTGTTGCTCAGCAGAATGGATGCTGCTCGTCTTGATCAACACTCGGAGATCACAGTA
GTGTTCTTGCAAAACTCAATTGGTTGTTCTTCCCCTGTAAATTAAGTGTACTACTATCATGCCGTCTGTTGGAAGAAGTGTCATGTCCCCTAACTACAAC
AGTGCAGCAGATGCTGTGGCCTGTTTTAGCTGACTGTTAATATTTGCTATTTTAATGTGTTTCGTTTAATATTCACCTTCATTTGGTTAAAAAAAAAA
page-top