Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2260
Contig Information
Length 1024 bp
Tissue Shoot grown with cold treatment
Clones 6 Clones [Download: CSV  ,  FASTA ]
whsc20a12    whsc8a20    whsc8n24    rwhsc20a12    rwhsc8a20    rwhsc8n24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit seed maturation protein [Zea mays]
Score 1023
Evalue 3.59621e-109
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2260
AGCTCGGGAGGAGAGCGTGGGGGGACTAGGGAGCATGGCGGAGCACAAGGAGGAGCCGGTGGCGGAGTCCATGATGGACAAGATCTCCGACAAGTTCCAC
GGTGGGGACTCGTCGTCGTCGTCCTCGGACTCGGACGACGAGAAGAAGGGGTCGGCGGCGGGCGTCAAGGCCAAGATCTACCGCCTCTTCGGCCGCGAGA
AGCCCGTCCACGCCGTCCTCGGCGGCGGCAAGCCTGCTGATCTTGTTCTATGGAGGAACAAGAAGGTCTCCGGAGGGGTGCTTGCTGGCGCTACTGCCAT
CTGGCTGCTGTTCGAGGTCATGGAGTACCATCTGCTCACCTTGGTGGGCCACTGCCTCATCCTCTCCCTGGCAACCCTCTTCCTCTATTCCAATGTCTGC
ATTTTCATCCACAAGTCTCCCCCGAACATCCCTGAGGTGAAAATCCCGGAGGACATGACTGTAAACATTGCACTATCACTGCGGCATGAGATCAACCGGG
GCTTCTTTACCTTGAGAGAGACTGGTCATGGTCGTGATCTGAAGAAATTCCTCATTGTGATTGGAGGGCTCTGGCTTCTTTCTGTTCTTGGGAGCTACTG
CAACTTTTTGACACTGTCATATATAGTCTTTGTGGTGCTGTACACTGTGCCAGTTCTGTATGAGAAGTACGATGACAAGGTGGATGCTTTTGGTGAGAAG
GCCATGATCGAATTGAAGAAGTATTATGCCATCTTTGAAGAGAAGGTCCTGTCGAAGATCCCGAAGAACAAGAAGCACTAGATCACAAGAGTTACCCTGC
CGCGTATTGCCATCTGTGTTAATCTCAACTTGTTGCCTCATTTTGAAGGATGGTTCTGTGTCATTGCGTCTGTCTTTAGTTAATACTACTTGATACTAGT
ACATATAGATGTGGTGTGCTAATCCTTTTGTGAAGTGGAGTCATGCCAGCTGAAGATTGTTGATCTTCTTTTTTTTGTTTATTTTTCAACTTTCAGCATG
GTTACTCTATCGGAGCCGGAAATG
page-top