Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2256
Contig Information
Length 612 bp
Tissue Shoot grown with cold treatment
Clones 6 Clones [Download: CSV  ,  FASTA ]
whsc1f04    whsc1f15    whsc4g21    rwhsc4g21    rwhsc1f04    rwhsc1f15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glycoprotein [Bromus inermis]
Score 592
Evalue 1.28421e-59
Total Hit Count 304
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2256
TGTAGCAAACTAGCTTGGGTATTCAATAACAGCCATGACAAAATATGAAGTAGTTCTCCGAAAACAGTTGTACTAATTCTGGCTTTAAGAACACTGGAAC
ATAGAGCAGATCCAACTTGGAACAAAAAACTCAACATGCCATCCACTAAGATAATCTAAGCAGCAACCTCCTTCTTGAGCTTGGCAAGCTCTTGCCTGAT
CGCACCACCCCTCTTAATCTTAGCCAACATGACCTTGAACCTGTCAAAGTCATTCAGCGATGCTCTTCTCTTCTGGACAACAAGCTTCTTACCCCATGAG
CTGTTCTCCCATTTGGTTTTCACATCTGCTTCCTCCATGGCCTTGATCAAAGTTGCCTTCTTAGGGATACGCTTGATGTCAATCTTGATGTCGGTCAGCG
AAAGACGCTTGAAGTTCATCTGGCACCTGACCATATCAGGAGCATCCACAAGTGCCCGGTTCTGGTCGACGACGTCGACGATGACGACGAGGCGGCCGTA
GTCCTTGCCGTAGTTCACCAGGGCCACGCGCCCGATCTCGACGAACCTCTTGAACGGCATCTTTGCGTCGGCGGCGTGGGGCGAGACGGCGAGGCGAGGA
GACGGGTGGGCG
page-top