Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2255
Contig Information
Length 1097 bp
Tissue Shoot grown with cold treatment
Clones 6 Clones [Download: CSV  ,  FASTA ]
whsc1e23    whsc10g09    whsc8i16    rwhsc10g09    rwhsc1e23    rwhsc8i16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit iron-sulfur protein1 [Zea mays] >gi|1717957|sp|P49727|UCRI_MAIZE RecName: Full=Cytochrome b-c1 complex subunit Rieske, mitochondrial; AltName: Full=Ubiquinol-cytochrome c reductase iron-sulfur subunit; AltName: Full=Rieske iron-sulfur protein; Short=RISP; AltName: Full=Complex III subunit 5; Flags: Precursor >gi|168607|gb|AAA33507.1| Rieske Fe-S protein
Score 1150
Evalue 7.46863e-124
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2255
TAGGGAGCAAGAACCAGAAGAGGTGTACAATATCCTTCCAATAGGGTCTCAGAAAATCAGTACAAAACTTACAATCCAGTAGCAACATAGGAGAAACAAT
TATTTCGCACTGCAAATGAACTTCGGTAGGTAACAGTGGATCACCGTTGCGATAGTCCTGAAACAAAAACTCCTAGCCACATTGAAAACAAAATAACAGC
GCAACAGGAATTCACTCCTGTGGAGAATATATGTTGGTAGGTACTGGTTTTAGGCTCTTAGCCTATGAGCATCTTGTTATCTTCCAAGAAACTGTAGGTG
GGCACCTCAAGGTTGTACGGGGCAGGGCCCTTGCGGATTCTGCCAGAGATGTCATAGTGGGAGCCATGGCACGGGCAGAACCAGCCACCAAAGTCTCCAG
AGTTGGGAAGGGGAATGCAACCAAGATGAGTGCAGACACCAATAACCACCAGCCACTCTGGGTTCTTCACACGCTCAGCGTCTTGCTCTGGGTGGCGCAG
GGATGCAACATCCACGCTGTTGGCCAGCTTGATGTCATCGTCTGTCCGTCGCCTGATGAAGACTGGCTTTCCACGCCACTTGACAGTCACTGTGCTGCCG
GGTTCAATGCTGGATAGATCAACCTCAAGGGAAGCAAGTGCAAGAACATCCTTACTTGCTGACATGCTCAAGACAAACTTCAAGACAAGGAGACGCAGCA
GTGATGCATATACGAATCTCCCACCACTCAGAACAAAGTAGGCAAAGGCACGCTTGCTGGGATCTCCAGGAGGATATCTTTCATGGTTGTACTGGTCATA
AAGGATTTTTGAGTTGGGGTTCTTCAGTGCAGCAACAGTGGCTGGGAGTTCAGCCAACCCAGCATCTTGGTTCCGTGGAACAAGTGTTTCAGCCGAAGAA
AAGCCTCTCGCGGCGGTGAAGAAGGGGGACTCGATGGCGAACCGCCGCTGGTAGGCCGAACCGTCGTCGTCGTCTCTCCCAGGGCCGCCGGCGCCGGCGA
GCGGGCCCCTGGCTCCGACGGTCGCCACGGGGCGCCAGGAGAGCGAAGACGAGAGCCTCCTCCCCGCAACCCTCAGCATCTCGTCGGCGTCGTCCTC
page-top