Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2251
Contig Information
Length 732 bp
Tissue Shoot grown with cold treatment
Clones 6 Clones [Download: CSV  ,  FASTA ]
whsc4n15    whsc18i22    whsc9b24    rwhsc4n15    rwhsc18i22    rwhsc9b24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 60S ribosomal protein L17-1 >gi|19102|emb|CAA44598.1| ribosomal protein L17-1 [Hordeum vulgare subsp. vulgare]
Score 867
Evalue 2.44711e-91
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2251
CGGCACGAGGCTCTACTGCACCGCCGCAGCCATGGTGAAGTACTCGACGGATCCCGCCAATCCCACCAAGTCCGCCAAGGCCATGGGCCGGGACCTGCGT
GTTCATTTCAAGAACACTAGGGAAACAGCGTTTGCCCTGAGGAAGATGTCGCTCAACAAGGCCAAGAGGTACCTTGAGGATGTGTTGGCACACAAGCAAG
CCATCCCCTTCCGGAGGTACTGCCGTGGTGTTGGACGCACAGCCCAGGTGAAGAACCGTCAGCCCAATGGTCAGGGACGCTGGCCTGCCAAGTCTGCTAA
GTTCGTTCTGGATCTTCTAAAGAATGCTGAGAGCAATGCTGAGGTGAAAGGTCTTGATGTTGATGCTCTCTACATTTCACACATCCAAGTGAACCAGGCC
CAGAAGCAGCGGCGCCGGACCTACCGTGCCCATGGACGCATCAACCCCTACATGTCCAACCCATGCCACATTGAGCTGATCTTGTCGGAGAAGGAAGAGC
CGGTGAAGAAGGAGGCTGAGTCCCAGATTGCCAGGAAGGCCTAGAGAAGGAAGCTCTACATAACCTATCTGCCTATTCGTTAGAGCAGTTTGTAGCATCT
GGTCTGGCTGAGTCGAAATTTTTGGCCTATTATCTGTCGTCTAAATACTGCTAGCTCATACTTTGTGAAACCTTTTGATGATCGTCTCATGTACTGGATT
CAATCTGGTTGTGTTTTGGAATAAAAAAAAAA
page-top