Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2188
Contig Information
Length 844 bp
Tissue Shoot grown with cold treatment
Clones 6 Clones [Download: CSV  ,  FASTA ]
whsc20i12    whsc7e13    whsc9k04    rwhsc20i12    rwhsc7e13    rwhsc9k04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_19723 [Oryza sativa Indica Group]
Score 526
Evalue 1.10629e-51
Total Hit Count 365
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2188
GCTTCCGCCTCCACAGCCCCCACTTTCCAACTTAGGGTTCTAGGGTTTCTCCAGCAGCGCCGGCGCCTCCACCCGCCCACCCAACCACCATGACGGCCGA
GACCGCGACGCAGGCGGAGCTGCTCCGCGCCGTTCTGGAAGAGCAGAAGCTCGCTGCGCAGGGAGACGAGCCCGTAGTTGAGGATGATGATGATGAGGAA
GATGAGGATGATGATGACGAGGATGACAAAGATGATGATGTTGAGGGAGTTGATGCAAGTGGAAGATCTAAGCAGAGTAGGAGTGAGAAGAAGAGCAGGA
AGGCCATGCTGAAGCTTGGCATGAAGACTATCACTGGCGTGAGCCGTGTAACTGTCAAGAAGAGCAAGAATATCCTGTTTGTCATCTCCAAGCCAGATGT
ATTCAAGAGCCCTGCCTCTGACACCTATGTCATTTTCGGTGAGGCTAAGATTGAGGATCTGAGCTCACAGCTGCAGTCCCAGGCTGCCGAGCAATTCAAA
GCGCCTGATCTTAGCAGCGTCATCTCAAACCCTGAGGCTTCTACAGCTGTTCAGGAGGATGACGAGGATTGTGATGAGACTGGAGTTGAGCCTAAGGACA
TTGAACTGGTGATGACCCAGGCCGGTGTGCCTAGGCCCAAGGCTGTGAAGGCGCTCAAATCTGCTGACGGTGACATAGTCAGTGCTATCATGGAACTGAC
GAACTAGCCGGGCCCAGCCTGTGATATTCTGTCAGTTTTTCCTTGTTTACATGGGAATACATGAGTTGTAACGTTTGGTGGTCATGTGTGTGAACTTTGA
GCTGCTCTGTATTAGCAAAGACCTGAGGCAATGTCGAATGAGCT
page-top