Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2173
Contig Information
Length 612 bp
Tissue Shoot grown with cold treatment
Clones 5 Clones [Download: CSV  ,  FASTA ]
whsc1f01    rwhsc2m08    rwhsc15a07    rwhsc1f01    rwhsc20j02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit triticain alpha [Triticum aestivum]
Score 552
Evalue 5.55761e-55
Total Hit Count 259
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2173
CATCTGCTTATCATGTTTCTTGATGAATTCCATAATAACAATGGCAGCTCCAAACTGTGAGGGAATGAGCTGAGTTTTACATATACATATGCAAAAGCAA
ATTTGGTGGTTCTGTAAACGACCGAACCCGATTTTAGGATTATGTACAGGAGCATCTATTATAAAGAAGATACTAGAGAGCATAGCTATCGCCATGCTGC
GCCTTCGATTGTGGATCACCAGGTGATCATTTGCAGAAGTTAATCACCATGGCCGTTGGCTGTAGGATTGTGGTGATGCAAATGTTTACGCGCTACTTTT
CTTGCCGTCAGTTGCAATGACAGAGAAAGCACCGATAGGCTTGGCCAGGGTACGCCTCTGAGCCTTCACTGACAGTGGGCTGTCCTTGGCCGCAAGGCAG
GTTCCCTGCTGGGTGTTGCAGATGGGATAGTTATGAGGGCAGCAGCTGTAGTGATCATCGCAGCAGGTAGCACCCTCGAGTGGGCAACAGCCCCAGGCGA
AGCACTCCTTGCCGTACTCGTAGATGCAGCAGCAGGTCGTGCTCGCGGGGCACTCGTTGTAGCTGTCACAGACCGAAGACGGTGGGGCGGGAGATGGTGG
AGTTGGGCCGGG
page-top