Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2161
Contig Information
Length 565 bp
Tissue Shoot grown with cold treatment
Clones 5 Clones [Download: CSV  ,  FASTA ]
whsc1c11    whsc1c12    rwhsc1c11    rwhsc1c12    rwhsc1c23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit predicted protein [Postia placenta Mad-698-R]
Score 79
Evalue 3.21113
Total Hit Count 3
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2161
GGCTCGAATACATCAGCTCGAATAGAAACGAGTCAGCGGAAGCAACAATATCTGAGTACAGACATAAGTTAAACAAGTTTGCCTTAAGAAGGCTAGCACA
AAAGCAACATCGACCGAAAAGGCAAGGCCTCCTGCCTGGGAGCCTCCTAACTACTCCTGGTCATCCGCGGTCTCCGTCACGTGGTAGTAGGCACCCTCGG
GGTAGTAGCAGTCGTCAAAGGTGTCATCTGGCTCCTGGATTCCGTCATCTGGTTGCTTTGGCAAGGAGGGGTCGTCAACACCGTAGTCGTACTGGGTTTC
GCCGGCAGTCTCGGGGTGTTGAGCCTGTAGATGAGCAGAGCGGGCTCGGGGAGGCTCCAGCGAGGCCGAATCGAAGACGACGAGCGGCGAGATGCAGAGG
CGGAGATGAGCTCGATGGTGACGCGCGAGGCCCTCCCAGCTTGCTCCGATGGTTGGAGTCGACGGAGAAGAGGACGGCGGTGCCTCTAGGCATCTTGTCG
TAGCTCGGGGATGACCATGGCCACGGAGACCACGACGGCACGGCGACGGCTTCGCTCGGGGTTTG
page-top