Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2156
Contig Information
Length 548 bp
Tissue Shoot grown with cold treatment
Clones 5 Clones [Download: CSV  ,  FASTA ]
whsc1b06    whsc1b17    rwhsc2a17    rwhsc1b06    rwhsc1b17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit predicted protein [Botryotinia fuckeliana B05.10] >gi|150852469|gb|EDN27661.1| predicted protein [Botryotinia fuckeliana B05.10]
Score 89
Evalue 0.20509
Total Hit Count 5
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2156
ATGCATTACAAAGTGTAACCGATGCATTCCAGGCTCAACAAGACATTCACCAAGCACATTGAGGTGCCTAACATCACAAACAAGCTCCTCCACGCCAAGA
ATGCGTCGCTTACAGCCTCTGGATACAAACCAAAGTAGAAGGAAGAAGAAACAGAGACGAAACAAGAGGAAGGGAGGATATTCTCGGAGGAGGAACAAAT
AACTAGTTAAAAGATGCCTAGAAAAGAGAGAGAGAGAAAGAGAGATATACATATATCTCGGACCATAACGCCTCAATTCCCCACCGCACGCTCGCACCGG
CCGCCTCATGCATGCTCGCAGAGCAGAGCAGAGGAGGACGACGCAGTGAGAGCACAATGCGAGCCGCTAGCTCGCGCGCCCGCCGTCTCCTATCTGCAAG
GCTCGTCGCCGTTGGACTCGTCCGCTCCCGGGTCTCCAAATGCTGGCCAGGATGCACCGTCTGCAGCTGCAGAAGCACCGAGGAGCTCCATTGCTGGGGT
AGGAGGAAGATGGGGCATTTTCTTGAGAGGAGGAGATTACTATTCAAG
page-top