Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2135
Contig Information
Length 1002 bp
Tissue Shoot grown with cold treatment
Clones 5 Clones [Download: CSV  ,  FASTA ]
whsc1c09    whsc3o15    rwhsc3o15    rwhsc1c09    rwhsc1c10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cation transport protein chaC [Zea mays] >gi|195630483|gb|ACG36635.1| cation transport protein chaC [Zea mays]
Score 991
Evalue 1.77523e-105
Total Hit Count 444
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2135
ATAACACTTTCAAGTCTCAGGCTTTCGCATTAGCACTCTGGAAGCTACAGCCTTTGCCAAAGAAAATTAGCGCACACCCTCAATGGTGCCAGAGCTGAAG
TAAACCGCAGATCTTTCAATGGGAGAATGTCAAGGGTGAGTGTGGTCAGAGGAAAATGCCATCTCTTTCGCCGATCCAGCCGTGCCGCTCTTCTTGCTAT
GTTGAGACCACGACGGTGCCCTCAGGAAGAGCAGGGATGTGCAGAACGGGAGTATGCGATTTTAATGGCATGTCGGAGCCGGTAACCTTCTTCTCCGTCG
ACCTGCTCAGCACCTTCCTCACCTCATCCGCAAGCTCAATGATCGTGTCGTCTTCATGGCTTATATTGGACAGTGCCTTCTCCATTGAGAATAGGTAGTC
CCTATTATATCCATTAGGGCCACTGGCTGTAGCAATTTGCCTTGCCATATCCTCCAAAGCAGCAGGGCCAAGATAATATTTGTTGCCAACTGGATCAGGA
GTGGATACGAAAACTAATACATCCGTCACAGCTGGTTCCAGAGAATTTCCATCCTTGTAGAAATCCACAGAGATCTTCTGGTCATACTCGCATTCTCTTC
TCTCCAAGTACTGCATTGCTTCTCGTTCTTTTTCTAGACCACCTTTGACACAATAAGCAATTCCCCAGCATATGGCTCCATCTTCGGATTCAAGGGTGCA
GGTCCTGGCCGGATGCTGTGGTGTGCCTCTATGGTCAATGCAAGCGAGATTGAACGTTCGCTTGTAGCCCTTGATGAATCCCAGGATCTTGTCGTCGAAG
TCGAATCCGGGGTTCCAGATCAGGGACCCATACCCGAATACCCACAGCACCATCCTGGCCGGAGGAGGGGCGCCGGAGAGAATGCCGCGGGTGGGTCGGC
GGCGCGGGAGGAGGAGCAAGATGGGGATTTGACGCTCCTCTTGCCTCGCCCGCGTCTCCTCTCCTCCGCCGGCGGTCTTCTCCCCCGGACGGACGGGATG
GG
page-top