Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2130
Contig Information
Length 643 bp
Tissue Shoot grown with cold treatment
Clones 5 Clones [Download: CSV  ,  FASTA ]
whsc1d05    whsc1d06    rwhsc1d05    rwhsc1d06    rwhsc7d22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ubiquinol-cytochrome c reductase complex 14 kDa protein [Zea mays]
Score 453
Evalue 1.8785e-43
Total Hit Count 128
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2130
ATAGCAACAATTCCGTCAACCAAAACAAACTTTTATATCAGCAACAGCAACAGAAATTCTGTCGCAATTAATTTGGGAAGGGGCACGAGCTACAGGCCAT
GGACATGAAACCGGAAGGAGGAACAGTGTCATAATCTGCATTTTATTTCATGCATTGTGATGCTACGAGGAGCAAAAGCTGTGGCGCATATCAAGGAAAA
ATGTCTTCAAGGAAGGGTTCTCTCGTAGAGGGGAAGGGCTCCCAGTGCTTTACGCTCTGCTGCCTCCTTTTTCACCAGAGCCAGCATGTCGCTCAAATAG
CTTTTGAATGGTGTCTGCAGTGCCCGGACGTCGTCGGGGAGGTACTGGTGCTTCATGGAGAGGTCCATGGCGCGCTTGAGGCGCTGGTGGCGGGCGTCGA
CCACCTCCCGGGGCAGCCTGCCGAGCGCCTCCTTGATGTCCAGATCGAAGTAGGGGTCGTACAGGTCGTCGTACCTCAGGCCGTAGTTCTTGAGGCGGTT
GGAGATGGTGAGCATGTGGATGCGGGCCAGCGGGTTGCGGCGCGGGTTCACGAACCACGACGAGAACGCGGACAGCATCGACGTCATCCTCGGCGGCGGC
GGCGGCGGCGATCCCCTTTCGTCTCCTCTCTTCTTCGGCGTTG
page-top