Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2076
Contig Information
Length 1768 bp
Tissue Shoot grown with cold treatment
Clones 5 Clones [Download: CSV  ,  FASTA ]
whsc1g11    whsc5c04    whsc13e01    whsc15n06    whsc18e14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0118400 [Oryza sativa (japonica cultivar-group)] >gi|38344860|emb|CAE01286.2| OSJNBa0020P07.3 [Oryza sativa (japonica cultivar-group)] >gi|113563628|dbj|BAF13971.1| Os04g0118400 [Oryza sativa (japonica cultivar-group)] >gi|116308871|emb|CAH66007.1| H0613H07.5 [Oryza sativa (indica cultivar-group)] >gi|119395218|gb|ABL74570.1| elongation factor [Oryza sativa (japonica cultivar-group)] >gi|125589153|gb|EAZ29503.1| hypothetical protein OsJ_012986 [Oryza sativa (japonica cultivar-group)] >gi|215704910|dbj|BAG94938.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215715300|dbj|BAG95051.1| unnamed protein product [Oryza sativa Japonica Group]
Score 2635
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2076
CGGATCGGGAGCGCCGCCGCTTCCCCACCTCTCGTCTCTCGGCGAACCCCCAAGGAACTATATTCCCAGCGTGATATCCAAAACCAGTCAAGATGGTGAA
GTTTACTGCGGAGGAGCTCCGCGGAATTATGGACAAGAAAAATAATATTCGTAACATGTCTGTTATTGCTCATGTCGACCACGGCAAGTCTACGCTTACG
GATTCCCTTGTGGCAGCTGCTGGGATTATCGCCCAGGAAGTTGCTGGGGATGTTCGCATGACCGATACCCGTGCAGATGAGGCAGAGCGTGGTATTACAA
TCAAATCCACGGGTATCTCTCTTTTCTATCAGATGACTCCTGAATCACTTGAGATGTACAAGGGCGACAGGGATGGAGATGAATACCTGATCAACCTTAT
TGATTCACCTGGCCACGTTGACTTTTCTTCGGAAGTCACAGCTGCTCTTCGTATCACTGATGGTGCTTTGGTGGTTGTTGACTGTATTGAGGGTGTCTGT
GTGCAGACCGAAACTGTGCTGCGCCAAGCTCTTGGTGAGAGGATTAGGCCCGTCCTCACCGTGAACAAGATGGACAGATGCTTCCTTGAGCTTCAGTTTG
AAGGTGAGGAAGCATATCAGACTTTCTCCCGTGTCATCGAAAATGCCAATGTCATCATGGCAACATATGAAGATGTGCTCCTTGGTGATGTCCAAGTGTA
CCCAGAAAAGGGGACTGTTGCATTCTCTGCTGGTTTGCATGGGTGGGCTTTCACCCTTACAAACTTTGCTAAGATGTATGCCTCCAAGTTTGGAGTTGAT
GAGTCGAAGATGATGGAGAGGCTGTGGGGTGAGAACTTCTTTGACCCAGCCACAAAGAAATGGACCTCCAAGAACACTGGGACAGCTACCTGCAAGAGAG
GTTTCGTTCAGTTCTGCTATGAGCCAATCAAGCAAATCATAGCCACCTGCATGAATGATCAGAAGGATAAGTTGTGGCCTATGTTGAAGAAGCTTGGTGT
GACCATGAAGAATGATGAGAAGGACTTGATGGGCAAGGCTCTCATGAAGCGTGTGATGCAAACTTGGCTGCCTGCCAGTCGTGCTCTGCTTGAGATGATG
ATATTTCACCTTCCCTCTCCCTCAAAGGCACAGAGGTATCGTGTGGAGAACTTGTACGAGGGTCCCCTTGATGATATATATGCTAATGCTATCAGAAACT
GTGACCCTGATGGTCCTCTTATGCTGTATGTCTCCAAGATGATTCCAGCATCTGACAAGGGTAGATTCTTTGCCTTTGGACGTGTTTTTGCTGGGAGGGT
TGCCACTGGCATGAAGGTCCGTATCATGGGTCCCAACTTTGTTCCTGGCCAGAAGAAGGATCTGTATGTGAAGAGTGTCCAGCGTACTGTTATCTGGATG
GGAAAGAAGCAAGAGTCTGTTGAGGATGTTCCCTGTGGTAACACTGTTGCGTTGGTTGGTTTGGATCAGTTCATCACAAAGAATGCAACCCTGACAAATG
AGAAGGAAGTTGATGCCTGCCCAATCAGGGCAATGAAGTTCTCTGTGTCCCCTGTTGTGCGTGTTGCTGTTCAGTGCAAGGTGGCCTCTGATCTTCCCAA
GCTTGTTGAAGGTTTGAAGCGTCTGGCAAAGTCTGATCCTATGGTTCTCTGTACCATTGAANAGTCTGGTGAGCATATCATTGCTGGAGCTGGANAGCTT
CACCTTGAAATCTGTTTGAANGATCTGCAGGATGACTTCATGGGTGGNGCTNAAATTATTGTTTCCCC
page-top