Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2057
Contig Information
Length 1716 bp
Tissue Shoot grown with cold treatment
Clones 5 Clones [Download: CSV  ,  FASTA ]
whsc2e11    whsc3b04    whsc11n17    rwhsc3b04    rwhsc11n17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os09g0527900 [Oryza sativa (japonica cultivar-group)] >gi|52077327|dbj|BAD46368.1| unknown protein [Oryza sativa Japonica Group] >gi|113631966|dbj|BAF25647.1| Os09g0527900 [Oryza sativa (japonica cultivar-group)] >gi|215768601|dbj|BAH00830.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218202491|gb|EEC84918.1| hypothetical protein OsI_32118 [Oryza sativa Indica Group]
Score 715
Evalue 3.77965e-73
Total Hit Count 413
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2057
CTGGACACCACTATGCTTAGAGCACATGGGCTTGTGACATGGTTTACCCACTTACACATACAGAATACCATGACATTAATTGGTTTTGATGGTAACAGAA
CTCTAGCAACACAGAGCAAACAGTTCAGAATGGAGGACTGACAGCCAACTACCAACAGAAACCATAGATACGCAGGAGTCTGTCATGGAGAAAGCAATAT
TAGTACTAGTACTCGAGCAGCTCAGAATGGAGGTCCCAGCACCAACGGACAAGAAACCATTATCAATACTAGCAGCGATCGTCGGCTCTACAACAAACGT
GACCTCACACAGGCAGAGGCTTTCGGCCACGAGGCAGAGGCCATTTTTGACGTGGCAAAGGCTTGGCTCTACGACCAACGAAGCGTGGCTCAGGCAACGG
CCATTTGTTTCCATCAATCGGTGCAACAGTTTCAGTGTTTCTGTGTGTCCCGCCAGGCAACAACCATCTGTTTTCAACATCCTCGACAATAGTACCATCT
GCACTAGTCCGTTTTTTATTGAAGTTCAACAAGAGGTGGTGAATAACATCCCTCGGCAGGAACGGAGTTTCTTCCTCATCATAAAAGTTCATTCCAACAA
AATTCCCATCATTGTCAATAAGAGGCCCCCCAATCCCAGCCTTGGTGATTTTACAGGTGGAGACACAAAGTTCTTTGCAATCAAGTTTGCTTTGTTTGCC
AATCAACACCTTCCCCTCAACAGCCATTAGTTTGCGACACGCAAAAAGACTACCCACAGCTATTACGTCCATAGATGAGGTAAACTGGATGCCCATGGAT
TTTTATTGTACGAGGACGCCAGAATCCCATGATGTCAACAAGAGCAACATTGTACTGTAAATTATAACAGTTCAATATCCCCCTCGTGCCGAATTCGGCA
CGAGGTTTTTTGAGAGATCTATTATTTCTTTGTACAGTCCCTGATAGCATACAACAGAAATCCGCAACACAGCGTCTAGTGCATGCCATGGCTGAATCCA
GATACAGTCGTTAGCTTCGTCTCTAGTAAAAAACAACACACATTCTAAGGTCCCTGCAACGATACATTTAGCCTGGCCACTAAGGCTAAAGCTAATTCAA
GCTCCCGGTGCGGACGAAATGTTTATAACAGCAACCGAAGCAATTTACATTCTGAGATTCCAATGTTTACTTGTCGGTGGCTCCATCGTAATTGCATGTT
GGGACCACTCCTGAAGAGTCATGGTTGTTGTTGTGGCTATGATCCACTCCATGAGTCTGGGAACTTGAACCTTGCCCATTATTACGAGCTGGCCTCATAT
TAAGATCAAACATTTTTGAGTCAATGGCACCCTGGCCGTTGCAATTGCCATCTGAGGCCGGATCATAGGCATTGTGGTGGTGGTTCACCATTTGCTCCTT
TGGTACGGAATGAGCGTTATTTTGGTCCCTTGGGTTTTCAGAGTCCATCTGTTGCATGGCTACATCGTCCATATGCCCTGGTTTATCTCCTGGAAATTCG
ACTCGTTGTCTTANCAGCAAGTATCTTCCATGGGTTCGTTTCCCACCAACATGAACAGCCATATCACAGCTCANGCAAAGTGATGTACCATCTATGTCAC
AGTANAAGAAAGCANGAGAACTTTCACATATATCACAGCGTATTAATTTATTANGGTCCGCAAGCCCAACCCTTACATGCCGACTANCAAGCTTGTTACN
CATATGTACCTTCTCG
page-top