Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2055
Contig Information
Length 1041 bp
Tissue Shoot grown with cold treatment
Clones 5 Clones [Download: CSV  ,  FASTA ]
whsc3j06    whsc13l03    whsc6o06    rwhsc3j06    rwhsc13l03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_38068 [Oryza sativa Indica Group]
Score 1095
Evalue 1.64173e-117
Total Hit Count 498
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2055
GCCCGACGCTCAGCCCCCAGACGCCGCAGCGCCGCCACTCCACCCGCAGCGGCAACCATGGCGGTCGGCAAGAACAAGCGCATCTCCAAGGGGAGGAAGG
GTAGCAAGAAGAAGGCCGTCGATCCGTTCACCAAGAAGCAGTGGTATGACATCAAGGCGCCGCTGCTGTTCACCAGCCGCAACGTCGGCAAGACCCTCGT
GTCCAGGACACAGGGTACCAAGATTGCCTCAGAGGGTCTGAAGCACAGGGTGTTTGAAGTATCTCTAGCTGATCTTCAGAACGACGAGGACCAGGCCTAC
AGGAAGATCAGACTCCGTGCTGAGGATGTGCAAGGGATGAATGTCCTCACCAACTTCTGGGGCATGGACTTCACCACTGACAAGCTCAGGTCCCTTGTGA
GGAAGTGGCAGACACTCATTGAGGCTCATGTGGATGTGAAGACAACTGACAACTACATGCTTCGCATGTTCGCCATTGGCTTCACCAAGAGACGCCCGAA
CCAGGTGAAGCGCACTTGCTATGCCCAAGCAAGTCAGATCAGACAGATCCGCCGCAAGATGGTTGAGATCATGGTCAACCAAGCTGCAAGCTGTGACTTG
AAGGAGCTTGTGAACAAGTTCATCCCTGAGGTGATCGGAAAGGAGATTGAGAAGGCCACCTCAAGCATCTTCCCCCTCCAGAACGTGTACGTCCGCAAGG
TGAAGATCCTGAAGGCCCCCAAGTTTGACCTGGGGAAGCTCATGGAGGTGCACGGTGACTACAAGGAGGATGTTGGTGTGAAGCTTGACAGGCCTGCTGA
TGGAGATGAGGTGATTCCTGGAGCGGAGGAGGTTGCTGCTGCTGAGTAGAAAATAGAAGTCGCTATTTTGCTGCTTCATATCTAGAAGATGATATATGTG
CCACCTGGGTGTCGTGAACTTTGTAGTCAGTTTTGATGGCTGATTTCTTGAGTACTTCTGTCGACATTCCTAGCCAGCGTTCAGTTATCTTATTTTGTTC
GTGTTACTTTTCTGGATGGAGGTTATGAGTGAAACTAAATA
page-top