Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig177
Contig Information
Length 783 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs16k01    rwhcs16k01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Ribulose bisphosphate carboxylase small chain PWS4.3, chloroplastic; Short=RuBisCO small subunit PWS4.3; Flags: Precursor >gi|170769|gb|AAA34301.1| ribulose-1,5-bisphosphate carboxylase/oxygenase
Score 800
Evalue 1.63568e-83
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig177
ATAATACATTACCATGGCCCCCGCCGTGATGGCTTCCTCGGCTACCACCGTCGCACCCTTCCAGGGGCTCAAGTCCACAGCCGGTCTCCCCGTCGGCCGC
CGCTCCAGCGGCAGCCTCAGCAGCGTCAGCAATGGCGGAAGGATCAGGTGCATGCAGGTGTGGCCAATTGAGGGCATCAAGAAGTTCGAGACCCTGTCTT
ACCTGCCACCCCTATCCACGGAGGCCCTCCTGAAACAGGTCGACTACCTGATCCGCTCAAAGTGGGTGCCCTGCCTCGAGTTCAGCAAGGTTGGCTTCGT
CTTCCGTGAGCACAACAGCTCCCCCGGGTACTACGACGGCCGATACTGGACAATGTGGAAGCTGCCTATGTTCGGGTGCACTGACGCCACACAGGTGCTG
AACGAGGTGGAGGAGGTCAAGAAGGAGTACCCTGACGCCTATGTCCGTGTCATCGGCTTCGACAACCTGCGCCAGGTGCAGTGCGTCAGCTTCATCGCCT
TTAGGCCACCGGGTTGCGAGGAGTCCGGCAAGGCCTAAACTACGAGTTGAAACAATGGCCTATCTCGTATGAAGGTCTTTTGTGAACTTCACTTTTGTCC
AAAACTCTGCTGTACGACTCTGCTTTCTGACCGGAGCATACCTTTTGTTCTATATGATTTTGTGTATGTATGTACGAACATAGGTTCTTGAGCATGCATA
CGTAATTCCTCATAGGTCTATATCTTCTTCTTCGGCACAACCCCCGAATACATCAATGGACGANATCTGTCTATACCTTTTCA
page-top