Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig1879
Contig Information
Length 796 bp
Tissue Shoot grown with cold treatment
Clones 4 Clones [Download: CSV  ,  FASTA ]
whsc1b12    whsc12a24    rwhsc12a24    rwhsc1b12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative glycine-rich RNA-binding protein 2 [Bambusa oldhamii]
Score 346
Evalue 7.49286e-31
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig1879
CCCCCCTCCCACGCCGTCTCGTCCCAGCTCGCCCTCCAGAGGTTTTAGTCTTCCTCCATGGCGGCCCTCATCAAGCTCGGAAGCCTTCTTAGGCAGAGTG
CTTTGGCGAGCAGTGCCTCGACCGGCTCGGCTCCTGCCCTGTTCAACGCTGCCCGCTTCATGTGCGCCGGCCAGCCAGCTGGTGGCAATAAGCTTTTCGT
CGGCGGTCTGGCCTGGGCTACTGACGATCATTCGCTGAAGGAGGCGTTCCAAAGCTTTGGAGAGGTCGTTGAGGCACGTGTCATCACTGATCGAGAGACT
GGAAGGTCTAGAGGGTTTGGTTTTGTGAGCTTTGCGAATGAAGCTGATGCAGATAGCGCTGCAAAAGGCATGGACGGTCAGGAGCTTGCAGGGAGGAACG
TCCGTGTGAACTTCGCCAATGAGAGACCTTCGGGTGGTGGCGGCTTCTCACGCGGCGGCGGTGGCTATGGAGGAGGTGGTGGCTTTGGCGGCGGCGGCGG
CTACGGCGGTGGTGGCCGAGGTGGCGGTGGCTATGGTGGTGACCGTGAAGCTTTCTAAGGAGAGCGCAGACTATCAAATTTAAAATAATGCGCTTTTAGG
ACAGTGTCTTGATTATGTGGAACCTATGTCACGTCTGTCTGTTATCTGCGATAGTTGAACTCAATAGGGGCAGAGATGTGGTTCTAGTATTTTTGTTTTT
GGTTCGTTTCTTGATGGTGCAAGAGTTTAAGTCATGCTGCTTCGAGGCTTGGATGAGTCTCAATGGAAGTTCATGCATTTTGCCGTANNAAAAAAA
page-top