Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig1832
Contig Information
Length 934 bp
Tissue Shoot grown with cold treatment
Clones 4 Clones [Download: CSV  ,  FASTA ]
whsc2j10    rwhsc2j10    rwhsc11h09    rwhsc12h08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_28114 [Oryza sativa Indica Group]
Score 264
Evalue 3.18494e-21
Total Hit Count 211
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig1832
TTTTTTTTTTGGTATTCCCTTCATCCAAAAAAGCTTATCCCTCAAATGATTGTATCTAGCACCATCCATTTAAAAGTTTGGGCCAAATTTTTTCGGACCG
AGGGAGTACTAATGATTGGCCATTTTATAGGAGATGCCTGACCACTTCTTGTCTTGGATACTTGGATAGAGGAAGTATTATAAAAACACTAGGTGTAACA
TATATAGTAGAATTCTGGCATTACAACATATAGCGGCAAGAAAATACTACAGACAAATGATACTAGGTCCACTAGGATAATGGGAAACACGGGGATACAG
TCGTCTAGACACGCGGCAGTTGCATCAGACCATTTTGTGGCTCAAAAAGTTTCTAATCGTCACCAAATGTGGTCTTCTTCCCTGCGCTAGCTGTGCCAGC
ACTCTGTCTGCTCTGAAAGCCTCGGCCGCCTCCTCTGCCGCCATCACGGCCACCAGACCGGCCAAACCTACTGCCGCCATCACGACCACCAGACCGGCCA
AACCTGCCACCACCAGACCGGCCAAACCTGCCGCCACCATCTCGGCCACCAGATCGACCACCAACCCCACCAAATTGACCCTTAGGCTTAGCTTCAGCAA
CATACAAGTTGCAGCCACCTAGGTCAGATCCACTAAGCTCAAGTGCTTTCGAAAAGGAACTCTCATCGGTAAAATCCATGTAAGCTATCCCTTTGCTTGC
ACCATTCTCATAATCCATCGGAACTGAGACACGTGTGAATTTCTCCACATTTAGAGAAGTGTTCTTGAAGAGAGCTCCGAATAGCATCCTCCTGTTGAGA
TGAATCAAAACCCTTGACAAATACTGAGAGGCTGGGACCTCCACTTGGTTTTCCAAAGATCCACCATCCCTGGTGCGAGGAGCGCTTGCGCCTCTTTCAG
CAGCCATGTCANGTCTGACGGGACGGCCCATTAG
page-top