Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig1817
Contig Information
Length 653 bp
Tissue Shoot grown with cold treatment
Clones 4 Clones [Download: CSV  ,  FASTA ]
whsc1e24    whsc7m11    rwhsc1e24    rwhsc7m11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_24555 [Oryza sativa Indica Group]
Score 530
Evalue 2.28228e-52
Total Hit Count 53
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig1817
GCCGGACGCATCCTCCTCAACGAGCATTGGATCCAGGATCTGCCGTATGACCGCACAGGAGAGCTCGAGAACCTCGTCTCCTTCGTCAATAACAACCTCG
ACCTCTGCAAATGGGCTGCTCTCGCTACCTTTGCCACTCAGGCACTCTCGCTTTTCTTGGCGATGGTTCTACGAGCCATGGTTTCACCCACGAGTAGCGA
CTATGACAGCGATGAAGATTTTGTGGTCATAAGGAGACCGCTGCTTATTGCCCAAGGAGCTCCATCCTATCTCCCTACCACGGCTGACCCCAGGGGTGGT
CATCCGAACTTATGGAGCTCATCAATGAGGCAGAAGTATGGACTGAACTCCTCAGGGGACTACACCTACAACACACTGGATCAAAATGCAGTGCGACCGC
AGTGAGAAGCTTCTGTGTGACAGGTGATGAGGAAGGAAGGGCATGCATGGCCTTGTTGGAAGCACCTGTGCAGCATACTCGTTGTATATCGTAATATTCC
ATTGTGTAATGCACACTATATACATTTGTGCACCCATTCACCCTGTCAATCTCGAACTCATTGTACATAGTTCCATTGTTAGTGAAGATCGGCTAGTTGG
GAAGGACTTGTTGTCAACATTTCGTTGGATGTTTATTGAGCTAGTTAGAGATA
page-top