Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig37
Contig Information
Length 545 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl53i03    rwhfl53i03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0815000 [Oryza sativa (japonica cultivar-group)] >gi|47847878|dbj|BAD21671.1| putative ribosomal protein L37 [Oryza sativa Japonica Group] >gi|113538029|dbj|BAF10412.1| Os02g0815000 [Oryza sativa (japonica cultivar-group)] >gi|125541603|gb|EAY87998.1| hypothetical protein OsI_09420 [Oryza sativa Indica Group]
Score 456
Evalue 5.59805e-44
Total Hit Count 291
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig37
ggtGCTCCCTTCTTCCTCCTCTCCTCTTCCCTCGGCGGCGGCGCAGGCGGCGCGGAGGCGACAGGCGAAGGCGAAATGACGAAGGGAACGGGCAGCTTCG
GCAAGCGCCGGAACAAGACCCACACGCTGTGCATCCGCTGCGGCCGCCGCAGCTTCCACCTGCAGAAGAGCACCTGCTCCTCGTGCGGCTACCCCGCCGC
CCGCATCCGCAAGTACAACTGGAGTGTGAAGGCCATCAGGAGGAAGACCACCGGCACCGGGAGGATGAGGTACATGCGCCATGTGCCCAGGAGGTTCAAG
AGCAACTTCAGAGAGGGAACTGAGGCCGCACCAAGGAGCAAGGGAGCCTCTTCCAGCGGCAACTAGGCGCGGCGGCCTTAACTTGTTACGCTAGGCGGAG
CCCTGATCATCAAACTTAGCTTTTTTGTTGCTTTCTACTGGAACCCTGATCATCAAACTTAGCTTTTTTGTTGCTTTCTACTGGAACTCTATGTTTCTAT
GTCGAGAGGCGGACGATATGATGCCTGGTTATGTTATTTGCAcaa
page-top