Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig1697
Contig Information
Length 704 bp
Tissue Shoot grown with cold treatment
Clones 3 Clones [Download: CSV  ,  FASTA ]
whsc20c24    rwhsc19c23    rwhsc20c24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit vacuolar proton-inorganic pyrophosphatase [Triticum aestivum]
Score 646
Evalue 9.52109e-66
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig1697
TTTTTTTTTTGTTCAAGGGTTCAAACATTATCGTCGTCATCACGGGACGAGGAAAATTTGCCAGACACATACCAATAATGACCGAGGACATCTGGTCTCT
CTCTTCTACTACATGGAGCTACAAGCCGGTAATGGTGAGACTAACGTAACACACCCAAGAGGCCAAAGGGAAAGTGGGGGTAAACTGCGGCAATCCTGGA
ATAATGACACAAGAACCAAAAATAACAGCAGCGCACAACATACGAACGGCGGGCGGGCGGGGCAGAGTTATTCGTGATGGTGTCCGTAGATTCTAAGTCC
GCTCGACGAGTCTTCTAGATGTACTTGAACAGCACACCTCCGTACGTGGCGAAGAAGGGCGCGAACACGAGGGACTCGACGGCCATCAGCTTGATGAGGA
TGTTGAGCGACGGGCCTGAGGTGTCCTTGAGGGGGTCTCCGATGGTGTCGCCGATCACGGCCGCCTTGTGGCAGTCTGAACCCTTGGGGCCAAGGGACCT
CGCGTGCTCGCTGTTGCCGGCCTCAATGTACTTCTTTGCGTTGTCCCATGCACCGCCGGTGTTGGAAGCAGAGATGGCGATCTGTACTCCAGAAACAAGG
GCACCAGCAAGAACACCANACAGGGTTTCCACGCCGAANAGGGTTCCGACAATGAGGGGGGTGAGCATGACCAAAGCACCCGGAGGAATCATCTCCCTGA
TGGA
page-top