Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig1631
Contig Information
Length 673 bp
Tissue Shoot grown with cold treatment
Clones 3 Clones [Download: CSV  ,  FASTA ]
whsc6a05    rwhsc4g08    rwhsc6a05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative glycine decarboxylase subunit [Triticum aestivum]
Score 781
Evalue 1.93582e-81
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig1631
TGAAGTTGGTGTAATTATTGTAGACAAGAGTAGTCGATATGGTTGCAACAAAAAGGAATGATAAGCGAGCAAGGAGCACTAGTGGGCGTCCTCCTCCTCG
CAGTGCTTGGTGTACTTGGCCGAGTCCAGCAGGCCCTCCAGCTCCGCCGGGCTGCTTGGCTTCACCTTGATCATCCACCCATCCTCGTACGGGCTCGAGT
TGATCAGGCCGGGGGTCTCGGACAGCTTTGAGTTGACGTCGACGACCTCGCCGGAGATGGGCGAGTTGACGTCGCTGGTGGCCTTCACACTCTCCACGTT
GCCGAAGGCTCCGCCCTGGCTCACCTTCGTGCCTGCCTCCGGCAGCTCCACGAACACCACCTCCCCGAGATGGCCCTGGGCGTGGTCACTGATGCCAATC
GTGGCCACGGAGCCGTCGTTCTTGACCCACTCGTGGGAGGAAGTGTACTTCAAGCCATCAATAACGGTGGAGAAGTATCTGGAGATCGAATAAGCCGGGG
CAGCAGCCCTGGCGCCGCTGCTTGAAATCTTGAGGGCATTGGCAGCTGAGCTTGCCCACAGCCTAAGAGCCATTGTAGCCTAATTTGGCTGTTGCAACCT
GAAGCAACAAAGTGAATGTGTGTTCTTTGCCCTCTCCTTGTAGGGGATGGTGCTCGGTGGTAGTAGTGGAAAG
page-top