Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig1527
Contig Information
Length 298 bp
Tissue Shoot grown with cold treatment
Clones 3 Clones [Download: CSV  ,  FASTA ]
whsc1a06    rwhsc1a06    rwhsc1a17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit GI14297 [Drosophila mojavensis] >gi|193909190|gb|EDW08057.1| GI14297 [Drosophila mojavensis]
Score 74
Evalue 7.91384
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig1527
TTTTTTTTTTGGCTTCAGAAATATAATGTATAACGAGGTATATGCTCATACAGAACTGATATTAAGTTTTCAGAATCTAATCCTCATAGGTCCATGTGTC
ATGATTCATACTCCTAACTGTACAAAGAAATATTGCTGACTTATTATTGTACTGCTAATACATGCTAAAATGTGAGGATTGATCTTACGGCATACCAATA
CATGATCGATGTAGTAGGATCCTCCTATCTCATCAAAAACAAGGCAGTGACAGCAGACAGCAACAGAGCCCCCATTTTCATGCCCATTCCCAGTGCTG
page-top