Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig1523
Contig Information
Length 514 bp
Tissue Shoot grown with cold treatment
Clones 3 Clones [Download: CSV  ,  FASTA ]
whsc1a19    rwhsc1a19    rwhsc1a20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100193701 [Zea mays] >gi|194693916|gb|ACF81042.1| unknown [Zea mays] >gi|195659367|gb|ACG49151.1| lipoprotein [Zea mays]
Score 483
Evalue 3.48007e-47
Total Hit Count 106
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig1523
CCTTCTAACTCTACATCCTCGGTTCCTCGCTCCGCCACTGCCTATGACTGTTATTCGGAAGTCCATCATTCTTCGAACACTCGCTCCATTTCCAAGAGGA
AAAACAAAGGGGTGGGAGACATTTTATTAACTACCCTATCTCCAGCTATCACACACCCATCTCTCGGACACGTACGAGAACACGCCAAGGGCAGATCAGG
TGAAAATCCTGGCTCCAGTATTGGCAGCCGGAAGATCGACCTCGCGGATCTCCGTCTTCAAGCCCTTCCCAGCAGCGTTGGCCAGCGGGTGGATGCCGTG
CGCCGGCCCGCTCATGTACGCCCGGTTCTCCCTCTCCTTCTGGAACGACACGCTGAACTTCTTCTCCACACAGTCGGCGAGGTCCTGCCGGAGCTGGCCC
TCGCGGGTGAGCGCCATCATGATCTGCGGGAGGCCGAGCGGGAGGGCGTCGCCGCGGTCGACCTGCCAGAAGTGGACGGTCTTGCCGTACGTCTTTGCCA
CCTGCTCGAGGTCG
page-top