Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig1520
Contig Information
Length 613 bp
Tissue Shoot grown with cold treatment
Clones 3 Clones [Download: CSV  ,  FASTA ]
whsc1c07    rwhsc1c07    rwhsc1c08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os09g0502000 [Oryza sativa (japonica cultivar-group)] >gi|113631817|dbj|BAF25498.1| Os09g0502000 [Oryza sativa (japonica cultivar-group)] >gi|125564262|gb|EAZ09642.1| hypothetical protein OsI_31926 [Oryza sativa Indica Group] >gi|125606230|gb|EAZ45266.1| hypothetical protein OsJ_028749 [Oryza sativa (japonica cultivar-group)] >gi|215767820|dbj|BAH00049.1| unnamed protein product [Oryza sativa Japonica Group]
Score 648
Evalue 4.10253e-66
Total Hit Count 431
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig1520
TGCGACCGACAAAACCAGAATAGTACATTTCACCATTGCTCACACCAAAAAGAAGGTCCATACATGAAATCTTGCAAAATGGCAGTATTTTTCTTCTCAA
ACAGGGATGTAATGTCTACTACAAAGGTAGCAACCAAGACTAGTTGACTAGATAATGCTTTACTCGTCCTCCTGGCTGCGGAGCCTAGCAAGCTTGTTGG
TGACCACGACGTCGAGCTGCGCAGCACGCTCCACGATCGCCTTGCGCTTCTGGGTGGACACGTTGTGTGCGATCTCGGCACAGTAGGTCCTGTTGTGCAT
CATGAGCAGCTCCAGCTCAGAGACATTGTGGACAACGAACTTCTTGAACTTGTTGGGCAGGTAGTGCCTTGTCTTCTTGTCTGAACCGTACCCGATGTTG
GGCATCAAGGTGCATCCCTTGAACTTCCGCCTGACACGGGAGTCGATACCCTTTGGCCTACGCCAGCTTTGCTTGAGGCCGATGTAGCGGTCGCTGTGCG
CCCTCTTGAAGTGCTTCACCCTCTTCTTCACGATCGCCTTCTTCAGCAGAGGCACCGCCATCTTGGGAGAACTGCGGCGGAGCGGGCGGGCGGGCGGCGG
CGGCGGCGTATGG
page-top