Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig1501
Contig Information
Length 622 bp
Tissue Shoot grown with cold treatment
Clones 3 Clones [Download: CSV  ,  FASTA ]
whsc10n18    rwhsc10n18    rwhsc14e05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ubiquinol-cytochrome c reductase complex 14 kDa protein [Zea mays]
Score 449
Evalue 5.07521e-43
Total Hit Count 128
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig1501
TTTTTTTTTTCAACCAAAATAAACTTTTATATCAGCAACAGCAACAGAAATTCTGTCGCAATTAATTTGGGAATGGGCACGAGAAACTGCTACAGGCAAT
GGACATGAAACCGGAAGTAGGAATAGTGTCATAATCTGCATTTTATTTCATGCATTATGATGCTACGCAGGAGCAAAAACTGTGGCGCATATCATGAAAA
GAAGTCTTCAAGGAAGGGTTCTCTCGTAGAGGGGAAGGGCTCCCAGTGCTTTACGCTCTGCTGCCTCCTTTTTCACCAGAGCCAGCATGTCGCTCAAATA
GCTTTTGAATGGTGTCTGCAGTGCCCGGACGTCGTCGGGGAGGTACTGGTGCTTCATGGAGAGGTCCATGGCGCGCTTGAGGCGCTGGTGGCGGGCGTCG
ACCACCTCCCGGGGCAGCCTGCCGAGCGCCTCCTTGATGTCCAGATCGAAGTAGGGGTCGTACAGATCGTCGTACCTCAGGCCGAAGTTCTTGAGGCGGT
TGGAGATGGTGAGCATGTGGATGCGGGCCAGCGGGTTGCGGCGCGGGTTCACGAACCACGACGAGAACGCGGACAGCATCGACGTCATCCTGGGCGGTGG
CGGCGGCGGCGGCGGCGATCCC
page-top